ID: 1058093400

View in Genome Browser
Species Human (GRCh38)
Location 9:100830774-100830796
Sequence GTATAAAAAATGTACAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058093400_1058093403 28 Left 1058093400 9:100830774-100830796 CCTCCTCTGTACATTTTTTATAC No data
Right 1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058093400 Original CRISPR GTATAAAAAATGTACAGAGG AGG (reversed) Intergenic
No off target data available for this crispr