ID: 1058093401

View in Genome Browser
Species Human (GRCh38)
Location 9:100830777-100830799
Sequence ACTGTATAAAAAATGTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058093401_1058093403 25 Left 1058093401 9:100830777-100830799 CCTCTGTACATTTTTTATACAGT No data
Right 1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058093401 Original CRISPR ACTGTATAAAAAATGTACAG AGG (reversed) Intergenic
No off target data available for this crispr