ID: 1058093403

View in Genome Browser
Species Human (GRCh38)
Location 9:100830825-100830847
Sequence TTGCTGACATTGTTGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058093400_1058093403 28 Left 1058093400 9:100830774-100830796 CCTCCTCTGTACATTTTTTATAC No data
Right 1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG No data
1058093401_1058093403 25 Left 1058093401 9:100830777-100830799 CCTCTGTACATTTTTTATACAGT No data
Right 1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058093403 Original CRISPR TTGCTGACATTGTTGAAAAC TGG Intergenic
No off target data available for this crispr