ID: 1058093403 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:100830825-100830847 |
| Sequence | TTGCTGACATTGTTGAAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058093400_1058093403 | 28 | Left | 1058093400 | 9:100830774-100830796 | CCTCCTCTGTACATTTTTTATAC | No data | ||
| Right | 1058093403 | 9:100830825-100830847 | TTGCTGACATTGTTGAAAACTGG | No data | ||||
| 1058093401_1058093403 | 25 | Left | 1058093401 | 9:100830777-100830799 | CCTCTGTACATTTTTTATACAGT | No data | ||
| Right | 1058093403 | 9:100830825-100830847 | TTGCTGACATTGTTGAAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058093403 | Original CRISPR | TTGCTGACATTGTTGAAAAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||