ID: 1058098219

View in Genome Browser
Species Human (GRCh38)
Location 9:100887744-100887766
Sequence TCTTCTCAGAGGAGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058098217_1058098219 -8 Left 1058098217 9:100887729-100887751 CCGGGTGGGGGTGGCTCTTCTCA No data
Right 1058098219 9:100887744-100887766 TCTTCTCAGAGGAGCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058098219 Original CRISPR TCTTCTCAGAGGAGCAAAGC AGG Intergenic
No off target data available for this crispr