ID: 1058102379

View in Genome Browser
Species Human (GRCh38)
Location 9:100931679-100931701
Sequence ATGGGAATGAAGAACTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058102374_1058102379 1 Left 1058102374 9:100931655-100931677 CCGGAAATTGGAGAGGGCAACTT No data
Right 1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG No data
1058102373_1058102379 2 Left 1058102373 9:100931654-100931676 CCCGGAAATTGGAGAGGGCAACT No data
Right 1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG No data
1058102367_1058102379 29 Left 1058102367 9:100931627-100931649 CCTTTTGAGAACTTCACTGTGAA No data
Right 1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058102379 Original CRISPR ATGGGAATGAAGAACTAGGA GGG Intergenic
No off target data available for this crispr