ID: 1058105761

View in Genome Browser
Species Human (GRCh38)
Location 9:100969901-100969923
Sequence GCTGCTGGTGGGAGTCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058105753_1058105761 9 Left 1058105753 9:100969869-100969891 CCGGGGCACAGAGAGGGCATAGT No data
Right 1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG No data
1058105752_1058105761 10 Left 1058105752 9:100969868-100969890 CCCGGGGCACAGAGAGGGCATAG No data
Right 1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058105761 Original CRISPR GCTGCTGGTGGGAGTCACTG GGG Intergenic
No off target data available for this crispr