ID: 1058108392

View in Genome Browser
Species Human (GRCh38)
Location 9:101002256-101002278
Sequence CCCGTCAACATGTTGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058108383_1058108392 11 Left 1058108383 9:101002222-101002244 CCTACCCAACATGTCCAAATTGT No data
Right 1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG No data
1058108382_1058108392 12 Left 1058108382 9:101002221-101002243 CCCTACCCAACATGTCCAAATTG No data
Right 1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG No data
1058108384_1058108392 7 Left 1058108384 9:101002226-101002248 CCCAACATGTCCAAATTGTAACC No data
Right 1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG No data
1058108385_1058108392 6 Left 1058108385 9:101002227-101002249 CCAACATGTCCAAATTGTAACCC No data
Right 1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG No data
1058108387_1058108392 -3 Left 1058108387 9:101002236-101002258 CCAAATTGTAACCCCAGGAACCC No data
Right 1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058108392 Original CRISPR CCCGTCAACATGTTGTAATG TGG Intergenic
No off target data available for this crispr