ID: 1058109566

View in Genome Browser
Species Human (GRCh38)
Location 9:101017663-101017685
Sequence AGGTGCCGGCACCTTTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058109566_1058109575 22 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG No data
1058109566_1058109570 -3 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109570 9:101017683-101017705 CCTGGTGAGAATTTTCTTGTTGG No data
1058109566_1058109572 9 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109572 9:101017695-101017717 TTTCTTGTTGGGTCCTCACATGG No data
1058109566_1058109571 -2 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109571 9:101017684-101017706 CTGGTGAGAATTTTCTTGTTGGG No data
1058109566_1058109573 15 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109573 9:101017701-101017723 GTTGGGTCCTCACATGGTGAAGG No data
1058109566_1058109576 23 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109576 9:101017709-101017731 CTCACATGGTGAAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058109566 Original CRISPR AGGTGCCGGCACCTTTATCT TGG (reversed) Intergenic
No off target data available for this crispr