ID: 1058109568

View in Genome Browser
Species Human (GRCh38)
Location 9:101017677-101017699
Sequence AGAAAATTCTCACCAGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058109568_1058109572 -5 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109572 9:101017695-101017717 TTTCTTGTTGGGTCCTCACATGG No data
1058109568_1058109577 17 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109577 9:101017717-101017739 GTGAAGGCAGAAGGGCAAAAAGG No data
1058109568_1058109573 1 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109573 9:101017701-101017723 GTTGGGTCCTCACATGGTGAAGG No data
1058109568_1058109580 22 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109580 9:101017722-101017744 GGCAGAAGGGCAAAAAGGGGAGG No data
1058109568_1058109576 9 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109576 9:101017709-101017731 CTCACATGGTGAAGGCAGAAGGG No data
1058109568_1058109579 19 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109579 9:101017719-101017741 GAAGGCAGAAGGGCAAAAAGGGG No data
1058109568_1058109575 8 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG No data
1058109568_1058109578 18 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109578 9:101017718-101017740 TGAAGGCAGAAGGGCAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058109568 Original CRISPR AGAAAATTCTCACCAGGTGC CGG (reversed) Intergenic
No off target data available for this crispr