ID: 1058109571

View in Genome Browser
Species Human (GRCh38)
Location 9:101017684-101017706
Sequence CTGGTGAGAATTTTCTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058109566_1058109571 -2 Left 1058109566 9:101017663-101017685 CCAAGATAAAGGTGCCGGCACCT No data
Right 1058109571 9:101017684-101017706 CTGGTGAGAATTTTCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058109571 Original CRISPR CTGGTGAGAATTTTCTTGTT GGG Intergenic
No off target data available for this crispr