ID: 1058109580

View in Genome Browser
Species Human (GRCh38)
Location 9:101017722-101017744
Sequence GGCAGAAGGGCAAAAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058109574_1058109580 -9 Left 1058109574 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG No data
Right 1058109580 9:101017722-101017744 GGCAGAAGGGCAAAAAGGGGAGG No data
1058109569_1058109580 16 Left 1058109569 9:101017683-101017705 CCTGGTGAGAATTTTCTTGTTGG No data
Right 1058109580 9:101017722-101017744 GGCAGAAGGGCAAAAAGGGGAGG No data
1058109568_1058109580 22 Left 1058109568 9:101017677-101017699 CCGGCACCTGGTGAGAATTTTCT No data
Right 1058109580 9:101017722-101017744 GGCAGAAGGGCAAAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058109580 Original CRISPR GGCAGAAGGGCAAAAAGGGG AGG Intergenic
No off target data available for this crispr