ID: 1058111195

View in Genome Browser
Species Human (GRCh38)
Location 9:101032104-101032126
Sequence GTGGCTGTAGCGACAGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058111193_1058111195 -6 Left 1058111193 9:101032087-101032109 CCTGGAAGTAGTTCTGTGTGGCT 0: 1
1: 1
2: 1
3: 20
4: 166
Right 1058111195 9:101032104-101032126 GTGGCTGTAGCGACAGATATGGG No data
1058111189_1058111195 18 Left 1058111189 9:101032063-101032085 CCAGGCAGAAATATCTCTGAAAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1058111195 9:101032104-101032126 GTGGCTGTAGCGACAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058111195 Original CRISPR GTGGCTGTAGCGACAGATAT GGG Intronic
No off target data available for this crispr