ID: 1058111360

View in Genome Browser
Species Human (GRCh38)
Location 9:101033762-101033784
Sequence CTGAAGCAGCTGAAACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058111357_1058111360 -5 Left 1058111357 9:101033744-101033766 CCTATTCCCACTTTACAGCTGAA 0: 1
1: 0
2: 7
3: 40
4: 318
Right 1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG No data
1058111356_1058111360 4 Left 1058111356 9:101033735-101033757 CCTATGACTCCTATTCCCACTTT 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG No data
1058111355_1058111360 24 Left 1058111355 9:101033715-101033737 CCTATTTAATCTTGACAACACCT 0: 1
1: 1
2: 7
3: 60
4: 407
Right 1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058111360 Original CRISPR CTGAAGCAGCTGAAACAGAG AGG Intronic
No off target data available for this crispr