ID: 1058114678

View in Genome Browser
Species Human (GRCh38)
Location 9:101071306-101071328
Sequence GAGGAAGAACAGATATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058114676_1058114678 -5 Left 1058114676 9:101071288-101071310 CCATCTGTAGGCAGTGCTGAGGA 0: 1
1: 0
2: 4
3: 27
4: 226
Right 1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG No data
1058114673_1058114678 11 Left 1058114673 9:101071272-101071294 CCAGAAGGATGGAAAGCCATCTG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058114678 Original CRISPR GAGGAAGAACAGATATTTGG AGG Intronic
No off target data available for this crispr