ID: 1058115068

View in Genome Browser
Species Human (GRCh38)
Location 9:101076119-101076141
Sequence GTGAGTAATGCAAATTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058115065_1058115068 6 Left 1058115065 9:101076090-101076112 CCAGCAGCATCAATATCATCTGG 0: 2
1: 18
2: 136
3: 592
4: 1318
Right 1058115068 9:101076119-101076141 GTGAGTAATGCAAATTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058115068 Original CRISPR GTGAGTAATGCAAATTCTCC AGG Intronic
No off target data available for this crispr