ID: 1058116976

View in Genome Browser
Species Human (GRCh38)
Location 9:101095430-101095452
Sequence TTGCCTGTATAAATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058116971_1058116976 26 Left 1058116971 9:101095381-101095403 CCTTGGAGGTTCCTGGTCTGGAT 0: 1
1: 0
2: 3
3: 16
4: 149
Right 1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG No data
1058116972_1058116976 15 Left 1058116972 9:101095392-101095414 CCTGGTCTGGATCTTTCTTGAGA 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058116976 Original CRISPR TTGCCTGTATAAATGGAGCT TGG Intronic
No off target data available for this crispr