ID: 1058117002

View in Genome Browser
Species Human (GRCh38)
Location 9:101095741-101095763
Sequence CAATATGCAGAGAAAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058117002_1058117010 28 Left 1058117002 9:101095741-101095763 CCAAGCTCTTTCTCTGCATATTG 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1058117010 9:101095792-101095814 AAGTATTTCTGGGCCTCTGAAGG No data
1058117002_1058117006 -6 Left 1058117002 9:101095741-101095763 CCAAGCTCTTTCTCTGCATATTG 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1058117006 9:101095758-101095780 ATATTGGAGGAGGAAACACTTGG No data
1058117002_1058117009 18 Left 1058117002 9:101095741-101095763 CCAAGCTCTTTCTCTGCATATTG 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1058117009 9:101095782-101095804 ACACACAGAGAAGTATTTCTGGG No data
1058117002_1058117007 -5 Left 1058117002 9:101095741-101095763 CCAAGCTCTTTCTCTGCATATTG 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1058117007 9:101095759-101095781 TATTGGAGGAGGAAACACTTGGG No data
1058117002_1058117008 17 Left 1058117002 9:101095741-101095763 CCAAGCTCTTTCTCTGCATATTG 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1058117008 9:101095781-101095803 GACACACAGAGAAGTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058117002 Original CRISPR CAATATGCAGAGAAAGAGCT TGG (reversed) Intronic
902624694 1:17669848-17669870 CAGTGTGCAGAGACAGAGCTGGG + Intronic
902719388 1:18293968-18293990 CAGTAGGCAGAGACTGAGCTGGG - Intronic
904810589 1:33161155-33161177 CAAGGCGCAGAGAAAGAGCCTGG + Intronic
906310879 1:44753459-44753481 CAAGATGCATAGGAAGAGCTTGG + Intronic
906689486 1:47783186-47783208 CAATGTGGAGAGAAAGAGAAAGG + Intronic
906866980 1:49432405-49432427 CAAGATGCAGAGGAAGAGATGGG - Intronic
907512874 1:54975349-54975371 CAACAGGCAGAGAAAGGGCAGGG - Intergenic
908144764 1:61228342-61228364 CAAGATGGATAGACAGAGCTGGG + Intronic
909221762 1:72972124-72972146 AAAAATGCAGAAAAATAGCTGGG - Intergenic
909327373 1:74367771-74367793 CAGTATCCAGAGAAAGATTTGGG + Intronic
909423958 1:75499681-75499703 AAATAAGAAGAGAAAGAGATAGG - Intronic
910849819 1:91639216-91639238 GAATATGCAGTGAAAGGGGTTGG - Intergenic
910984155 1:92989349-92989371 AAATATGAAAAGAAAGATCTGGG - Intergenic
911264311 1:95725398-95725420 GAATATGGAAAGAAAGATCTTGG - Intergenic
911666216 1:100556219-100556241 GAAGATGCAGAGAGAGAGATTGG - Intergenic
912163735 1:107017834-107017856 AAAAATGCAGAAAATGAGCTGGG - Intergenic
912313075 1:108642571-108642593 CAATCTGCAGAGAAGATGCTGGG - Intronic
912469528 1:109896896-109896918 CCATACACAGAGAAAGAGGTGGG - Intergenic
915602991 1:156933994-156934016 CCAGCTGCAGAGACAGAGCTGGG - Intergenic
916483436 1:165235860-165235882 GAAAATGCAGATAAAGAGCCCGG - Intronic
916623251 1:166524951-166524973 AAATGAGGAGAGAAAGAGCTGGG + Intergenic
919658924 1:200224097-200224119 CAATATGCAGAGAAGATACTTGG - Intergenic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
920867999 1:209769201-209769223 CATTCTGCATAGAAAGAGTTTGG + Intronic
922128876 1:222756985-222757007 CAATTTGAAGAGAAAGAAGTAGG - Intergenic
924309971 1:242730929-242730951 CAATAGGCACAGAAAAAGCACGG - Intergenic
924553797 1:245102019-245102041 CAATAAGTAGAGGAAGAGTTTGG + Intronic
924615482 1:245608473-245608495 CAAGATCAAGAGAAAGGGCTGGG - Intronic
1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG + Intronic
1064973288 10:21088136-21088158 CAATGTGGAGAGAAACAACTGGG - Intronic
1065598406 10:27341441-27341463 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1066218787 10:33315184-33315206 AAATCTGCAGAGATAGTGCTTGG - Intronic
1066603101 10:37129683-37129705 CTATTTGAATAGAAAGAGCTTGG - Intronic
1067306518 10:45069722-45069744 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1068106502 10:52623536-52623558 GAACATGCAGAGAAATAGCAAGG + Intergenic
1068980372 10:63056594-63056616 CAAGATGTGGAGAAAGAGGTTGG - Intergenic
1070803244 10:79255630-79255652 CAGAATGCAGAGACAGAGATAGG - Intronic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1072319600 10:94235605-94235627 CAATTTGCAGAGGAAGAGCATGG - Intronic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1073488780 10:103838872-103838894 CAAAATGGAGAGAAAAAGCAAGG + Intronic
1073562756 10:104510898-104510920 CTATATGGAGAGAGAGAGCGAGG - Intergenic
1074001506 10:109378290-109378312 CACTATGCACAGAGAGTGCTAGG + Intergenic
1074535625 10:114326634-114326656 CACTATGCAGAGACAGTGCAGGG + Intronic
1074699215 10:116078639-116078661 CATTACGCAGAGAAAACGCTGGG + Intronic
1075773940 10:124967277-124967299 CAATTTGAAGAGAAAGAGTTAGG + Intronic
1075953981 10:126506536-126506558 CAACATGCAGAGAATGGCCTGGG + Intronic
1076094796 10:127722422-127722444 GAAGATGTAGAGAAAGAGATAGG + Intergenic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1077398728 11:2341519-2341541 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1078005249 11:7527633-7527655 TAATATTCAGAGAAAGATGTTGG + Intronic
1079040116 11:17051967-17051989 CAAAATGCAGACACAGTGCTGGG + Intergenic
1079120287 11:17678634-17678656 CGATATGCTTATAAAGAGCTCGG + Intergenic
1079174445 11:18126074-18126096 CAATGTGCAGAGACACAGATAGG - Intronic
1080077657 11:28170496-28170518 CCATAGGCAGAGCAACAGCTTGG + Intronic
1080364972 11:31563438-31563460 CAGTAAGAACAGAAAGAGCTTGG + Intronic
1081197137 11:40175554-40175576 CACTCTGCAGAGGAAGAGGTTGG - Intronic
1083148227 11:60774066-60774088 CAATAAGAAGAGACAGCGCTAGG + Intronic
1085474592 11:76781964-76781986 GAATGTGCAGAGAAAAGGCTAGG - Intergenic
1085535956 11:77217889-77217911 CAATATACAGAGAAATTGCATGG + Intronic
1086114973 11:83239588-83239610 CCATATGCAAAAAAAGAACTTGG - Intronic
1087534870 11:99430658-99430680 CTATATAGAGAGAAAGAGCTTGG + Intronic
1089077268 11:115748109-115748131 CAGTTTGCAGAGAAAAGGCTGGG + Intergenic
1089328613 11:117674534-117674556 CAATATCCAGTGAGAGGGCTTGG - Intronic
1089682738 11:120128492-120128514 CCGTCTGCAGAGAAAGAGCCAGG + Exonic
1090618227 11:128536661-128536683 CATTAGGAGGAGAAAGAGCTTGG + Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1094736632 12:33242204-33242226 CAATATGCAGAGGAACTTCTAGG - Intergenic
1097960129 12:65524204-65524226 AAATATGCAAGCAAAGAGCTGGG + Intergenic
1098071853 12:66684422-66684444 CAACATGCTGTGACAGAGCTTGG - Intronic
1098756941 12:74375986-74376008 TACAATGCAGAGGAAGAGCTAGG - Intergenic
1098945048 12:76580563-76580585 CTATATGCAGAGAATGAAATTGG + Intergenic
1099728679 12:86468761-86468783 CACTAGGCAGAGAAAAAGATGGG - Intronic
1100731194 12:97471579-97471601 TAAAATGCAGAGGATGAGCTGGG + Intergenic
1102926067 12:116827404-116827426 CCATCTGCAAAGGAAGAGCTTGG + Intronic
1103184200 12:118942402-118942424 CAAGCTGGGGAGAAAGAGCTGGG + Intergenic
1103541645 12:121670260-121670282 AAATAGGCAGAGCAAAAGCTGGG + Intronic
1104318260 12:127724261-127724283 AAATATTAAGAGAAAGATCTTGG - Intergenic
1104968436 12:132520347-132520369 CCATCTGCAAAGAAAGAGATGGG - Intronic
1105224143 13:18412917-18412939 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1105426379 13:20298329-20298351 CAGGATGCAGACAAAGGGCTGGG - Intergenic
1106441710 13:29779920-29779942 TTATAAGAAGAGAAAGAGCTCGG + Intronic
1107319310 13:39168516-39168538 CAAAGTGCAGAGAATGACCTGGG + Intergenic
1107776181 13:43845351-43845373 AAATATGTAGATAAAGAGATGGG - Intronic
1109405094 13:61887310-61887332 CATTATGCTGAGAAATATCTTGG - Intergenic
1109458226 13:62622153-62622175 CCATATGCAGAGAAAGAAATTGG + Intergenic
1110551340 13:76814205-76814227 CAATATGCAGAGATATAGTGTGG + Intergenic
1110807652 13:79775944-79775966 CAATCTCAAGAGAAAGGGCTGGG - Intergenic
1112359970 13:98708567-98708589 CAGTTTACAGAGAAAGACCTTGG + Intronic
1112671440 13:101643899-101643921 CAGAAAGAAGAGAAAGAGCTTGG - Intronic
1112739697 13:102459049-102459071 AAATGTACAGAGAAAGAGGTTGG + Intergenic
1112836832 13:103525538-103525560 CAAGTTGCAGAGAAAGAACAAGG + Intergenic
1113223811 13:108136670-108136692 CAACTTGCAGAGAAAGAGCAAGG + Intergenic
1113544645 13:111138826-111138848 CATCATGTAGAGAAAGAGCTGGG + Intronic
1114008288 14:18337756-18337778 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1114770240 14:25422478-25422500 CAATATGTAAAGAATGAGGTTGG - Intergenic
1115582669 14:34777229-34777251 CAACATGCAGACAATGAGCATGG + Intronic
1115824629 14:37254558-37254580 GAATAGGCAGAGACAGAGGTTGG - Intronic
1117255326 14:53971500-53971522 CAATAAGCAGAGATAGAGTAGGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1122064018 14:99159322-99159344 TAATTTGCAGAGAAAGAGACAGG + Intergenic
1122778632 14:104134363-104134385 CAGTGTGCAGGGCAAGAGCTGGG - Intergenic
1123391484 15:19878344-19878366 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1124192013 15:27587793-27587815 GAATATTCAGAGAAACAGTTTGG + Intergenic
1125808970 15:42519996-42520018 CACTATGTAGTGGAAGAGCTGGG + Intronic
1126198644 15:45959751-45959773 TAATATGAAGAAAAAAAGCTGGG + Intergenic
1127673432 15:61217428-61217450 CAATGAGCAGAGAGAGAGATGGG + Intronic
1127707660 15:61562976-61562998 GAAGGTGCAGAGAAAGAGCATGG - Intergenic
1128277448 15:66365522-66365544 CAATATGCAGAGCAGCAGCTTGG - Intronic
1131349855 15:91689720-91689742 GAATATGCAAAGGAAGAGCTGGG - Intergenic
1133690378 16:8208712-8208734 AAATACGGAGAGAAAGAGATTGG + Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135012323 16:18892999-18893021 CAACATGCAGGTAAAGAGCCCGG + Intronic
1135319185 16:21480242-21480264 CAACATGCAGGTAAAGAGCCCGG + Intergenic
1135372081 16:21912035-21912057 CAACATGCAGGTAAAGAGCCCGG + Intergenic
1135439705 16:22458669-22458691 CAACATGCAGGTAAAGAGCCCGG - Intergenic
1135911396 16:26564749-26564771 CAAGAAGAAGAGAAAGAGCAAGG - Intergenic
1136329485 16:29562315-29562337 CAACATGCAGGTAAAGAGCCTGG + Intergenic
1136444113 16:30302022-30302044 CAACATGCAGGTAAAGAGCCTGG + Intergenic
1138817871 16:60223051-60223073 AAATATGCAAAGAAATACCTGGG + Intergenic
1139092443 16:63664829-63664851 AGAGATGCAGAGACAGAGCTTGG - Intergenic
1140070766 16:71647912-71647934 CCATAGGCAGAGAGAGAACTGGG - Exonic
1140137067 16:72216121-72216143 CAACAAGCAAAGAAAGAGCAAGG - Intergenic
1140792830 16:78408722-78408744 TAATTTGCAGATAAAGAGCAAGG + Intronic
1146106289 17:30040186-30040208 GAAATAGCAGAGAAAGAGCTTGG - Intronic
1148762327 17:50012878-50012900 CAATATGCAGAGAAGAATCTGGG + Intergenic
1149515281 17:57276535-57276557 AAATATGCAGAGAAAGATAGAGG + Intronic
1151599688 17:75098607-75098629 CAAAATGCCGTGAAAGGGCTGGG - Intronic
1152344939 17:79745737-79745759 CTAAATTCAGAGAAAGATCTGGG - Intergenic
1152377796 17:79927755-79927777 CAATATGAGGAGAAAGGCCTGGG - Intergenic
1153591537 18:6678657-6678679 AAATATGCAGAGAAAATGATTGG + Intergenic
1154529163 18:15326195-15326217 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1155332549 18:24732687-24732709 CAATATGCAGAGAGACAGTGTGG + Intergenic
1157154816 18:45255151-45255173 AAAGATGCAGAGAAAGAGAAAGG - Intronic
1157385627 18:47257801-47257823 CAATATGCAGAGAGAATGTTGGG + Intergenic
1157777724 18:50409000-50409022 CAATGTTCAGAGAAAGAAGTTGG - Intergenic
1158731337 18:60026586-60026608 GCATATGAAGTGAAAGAGCTCGG + Intergenic
1161326465 19:3666394-3666416 CAACGTGCAGAGAAAGCTCTCGG + Intronic
1163506763 19:17712094-17712116 CAATGTGCAGAGACAGAGTGGGG - Intergenic
1166289326 19:41851642-41851664 CAATATGCAGAGCAACAGAGGGG - Exonic
1168360448 19:55735442-55735464 AAATATGCAGATAAAGAGAAAGG + Intronic
1168487443 19:56776226-56776248 CAGAAATCAGAGAAAGAGCTGGG + Intronic
926503367 2:13681477-13681499 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
927173301 2:20388288-20388310 CCATGTGCAGAGAGAGAGCCAGG + Intergenic
928191941 2:29178752-29178774 ATATATGCAGAGAAAGAGATAGG - Intronic
930409419 2:51005131-51005153 GAATATCCAGAGAAAGATGTAGG - Intronic
932471779 2:71963880-71963902 CAAGATGGAGAGACAGGGCTGGG - Intergenic
933241171 2:79921959-79921981 AAATCTCCAGGGAAAGAGCTGGG + Intronic
935058583 2:99589112-99589134 AAATATGCAGAGATAGACATTGG - Intronic
936270084 2:111042623-111042645 CAATATTGAGAGAATGAGCCTGG + Intronic
936824527 2:116565144-116565166 CAACAAGAAGAGAAAGAACTGGG - Intergenic
937401867 2:121591218-121591240 CACCATGCAGAAAAAGAACTTGG + Intronic
937678018 2:124613374-124613396 CAAGGTGCAGAAAGAGAGCTTGG - Intronic
938150684 2:128879864-128879886 CTAGATGCTGAGCAAGAGCTTGG - Intergenic
938649723 2:133370231-133370253 AAATATGACCAGAAAGAGCTTGG + Intronic
941145353 2:161837127-161837149 AAATAAATAGAGAAAGAGCTTGG + Intronic
942006326 2:171703647-171703669 CATTATGAAGAGAAAGAGCAAGG + Intronic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
944214484 2:197240467-197240489 AAAAATTAAGAGAAAGAGCTGGG + Intronic
944637021 2:201684347-201684369 CAAAGTGCAGAGAAAAAGTTGGG + Intronic
944925121 2:204456436-204456458 CAAGAAGCAGAGAAATACCTCGG + Intergenic
945208152 2:207354330-207354352 CAATCAGCAGAGAAATAACTAGG + Intergenic
945415862 2:209571389-209571411 TAATATTCAGAGAAAGAAATCGG - Intronic
945850317 2:214998472-214998494 TAAAATGCAGACAAAGAACTTGG + Intronic
946060042 2:216933944-216933966 CAATAGGCTACGAAAGAGCTGGG + Intergenic
946268158 2:218566925-218566947 CGATATGGAGAGAAAGATCAAGG + Intronic
946349254 2:219138102-219138124 CAATATGTAGAGAAAGCCATAGG - Intronic
946714739 2:222541467-222541489 CTATATCCAGATAAAGACCTAGG - Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948272472 2:236685145-236685167 CCCTATGTAGAGAAAGAACTGGG - Intergenic
1168958591 20:1852406-1852428 TAATAAGCAGAGAAAAAGCCAGG + Intergenic
1173053308 20:39586479-39586501 CAATAAGGTGAGAAAGAGCTTGG - Intergenic
1173348727 20:42224972-42224994 CGGTGGGCAGAGAAAGAGCTGGG - Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1174448653 20:50607080-50607102 CAAAATGCAGAAAAGGAGCAGGG - Intronic
1174921283 20:54705056-54705078 CAAGATGAAGAGAAGGGGCTGGG - Intergenic
1175142332 20:56870293-56870315 CTATGTGCTGAGAAAGTGCTAGG - Intergenic
1175573565 20:60042454-60042476 CAATATGCAGAGAAATCACCTGG + Intergenic
1176768235 21:13042292-13042314 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1176909406 21:14545288-14545310 CCATTTTCAGAGAAAGAGATTGG - Intronic
1178136066 21:29629014-29629036 CTATATGCAGGAAGAGAGCTAGG + Intronic
1178268682 21:31168811-31168833 TAATACCCAGAGATAGAGCTTGG + Intronic
1179045616 21:37842641-37842663 CAACATGCAGAGAAACAGCATGG + Intronic
1179100897 21:38355033-38355055 CTATAGGGAAAGAAAGAGCTTGG + Intergenic
1179332391 21:40416514-40416536 AAATAAGCAGACAAAGAGTTTGG + Intronic
1179358523 21:40683841-40683863 CAGGATGCTGAGAAAAAGCTTGG + Intronic
1180432793 22:15268573-15268595 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1180515366 22:16136519-16136541 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1181013409 22:20055085-20055107 ACAGATGCAGAGAAAGAGCCAGG - Intronic
1181961419 22:26624671-26624693 CAGTAAGCAGACAATGAGCTTGG + Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1183972951 22:41492137-41492159 AAATAGGCACAGAAAGTGCTTGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949196388 3:1314209-1314231 AAATATTCATACAAAGAGCTTGG - Intronic
949516789 3:4814650-4814672 GAAGACGCAGAGGAAGAGCTGGG + Intronic
951834056 3:26961585-26961607 CAATATGCAAATTAAGAGATAGG + Intergenic
952533996 3:34291162-34291184 AAAAATTCAGAGAAAGAGATTGG + Intergenic
953827489 3:46266641-46266663 CATTAAGCAGGGAAAGAACTAGG - Exonic
954478562 3:50773889-50773911 CAATATTAAGTGATAGAGCTTGG + Intronic
955017787 3:55088814-55088836 CAAAGTCCAGGGAAAGAGCTTGG - Intergenic
956521549 3:70109505-70109527 GAACATGCAGGGGAAGAGCTTGG + Intergenic
957391576 3:79579794-79579816 AAATGTGCAGTGAAAGAGATAGG + Intronic
957889456 3:86336904-86336926 TAATATGTATAGAAAGGGCTTGG + Intergenic
958750588 3:98190205-98190227 GAATATGGAGAGAAAGAGAAAGG - Intronic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
960221531 3:115116261-115116283 TAATATGCCCAGATAGAGCTGGG - Intronic
961443916 3:126969322-126969344 CAATGGGGACAGAAAGAGCTGGG - Intergenic
961963062 3:130872268-130872290 CAATAAGCAGAGTAAGGGCTAGG - Intronic
963444709 3:145389370-145389392 GAAAAGGCAGAGAAAGAGATAGG + Intergenic
963991893 3:151665721-151665743 CAATATGGAAAGAAAGGGTTAGG - Intergenic
964321330 3:155500848-155500870 CAACATGCAGAGAATGAGCTGGG + Intronic
966600260 3:181768017-181768039 CACTCTGCAGAGAAAAATCTGGG - Intergenic
966947339 3:184786233-184786255 CAAAATGCTGAGAAAGTGGTGGG + Intergenic
968676605 4:1884690-1884712 CAATTTGCAGATAAAGAACGAGG - Intronic
969599719 4:8169085-8169107 CAATATGCAGAGCAGGAGAGAGG - Intergenic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970810369 4:20086389-20086411 CAAAAAGGAGAGAAAAAGCTTGG - Intergenic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
973191766 4:47393517-47393539 CAGTATGCAAAGAAAAAACTGGG - Intronic
973879771 4:55257761-55257783 TAATATGCAGAGACAGAACCTGG + Intergenic
973887989 4:55342100-55342122 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
975299262 4:72770575-72770597 AAATATACAGAGAGAGATCTTGG - Intergenic
975478135 4:74846176-74846198 CCATAAGGAGAGAAAGAGGTGGG - Intergenic
975770530 4:77716866-77716888 TAATTTGAAAAGAAAGAGCTTGG + Exonic
976911228 4:90308578-90308600 CAATATGCAGAAACTGAGTTTGG + Exonic
977340976 4:95757237-95757259 CAATTTGCATATAAATAGCTAGG + Intergenic
977446033 4:97133859-97133881 TTATAAGTAGAGAAAGAGCTTGG + Intergenic
977911529 4:102542879-102542901 TAATATTCAGAGAAAAATCTAGG + Intronic
978353830 4:107849098-107849120 CAACATGCAGAGAAACAGACTGG + Intronic
979808703 4:125008219-125008241 CATTATCCAGAGAAAAAGCAAGG + Intergenic
983196120 4:164808331-164808353 AAATATATAGAGATAGAGCTGGG + Intergenic
983804933 4:171983018-171983040 CAATATTTAGAGAAAGTGCAAGG - Intronic
985415473 4:189732013-189732035 CAGGATGCAGAGGAAGAGTTTGG - Intergenic
986066976 5:4244117-4244139 CAATATGCAGAAATAAAACTGGG + Intergenic
986581279 5:9268936-9268958 CAATTTCCAGATCAAGAGCTAGG + Intronic
990374289 5:55153864-55153886 CAACATGCAGTGAAAAAGATTGG + Intronic
992439821 5:76788361-76788383 CAAAAAGCAGAGAAAGAACTCGG + Intergenic
992753668 5:79884567-79884589 CTCTATGCTGAGAAAGAGCAAGG + Intergenic
993594291 5:89833202-89833224 CTATATGCATACAAAGCGCTTGG + Intergenic
993799437 5:92313713-92313735 GAACATGGAGAGAGAGAGCTTGG - Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
995581176 5:113604644-113604666 CAATATACAGAAATACAGCTGGG - Intergenic
996101220 5:119447738-119447760 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
997623480 5:135315890-135315912 CAATATACAGTTGAAGAGCTGGG + Intronic
997665412 5:135626284-135626306 CACTTTGCAGAAAAACAGCTGGG - Intergenic
998104622 5:139460582-139460604 CAAGAGGCAAAGAAAGAGCAGGG - Intronic
999024805 5:148216556-148216578 CAATATCTAGATAAAGAGCCAGG + Intergenic
999222941 5:149996703-149996725 TAACAGGCAGTGAAAGAGCTTGG + Intronic
999552194 5:152701555-152701577 CAATCTGCAGAGGCAGAGCTGGG - Intergenic
999631309 5:153574232-153574254 TTATATGGAGAGAGAGAGCTTGG + Intronic
1000106350 5:158062884-158062906 CAAAAAAAAGAGAAAGAGCTAGG - Intergenic
1000516638 5:162243609-162243631 TTATATGCATAGAAAGAGTTTGG - Intergenic
1001231763 5:169994770-169994792 GACTGTCCAGAGAAAGAGCTTGG + Intronic
1001287238 5:170432730-170432752 CAAAATGTAGGGAAAGAGCCCGG - Intronic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1004071324 6:12300689-12300711 CAGTAATCAGAGAGAGAGCTAGG + Intergenic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1005498974 6:26413392-26413414 GAATGTGCAGAGAAAAGGCTGGG + Exonic
1006261121 6:32871920-32871942 CAATTTTAAGAGACAGAGCTTGG + Intergenic
1006847825 6:37075093-37075115 AAGGATGCAGAGAAAGATCTTGG - Intergenic
1008252129 6:49253143-49253165 CAAATTGCAGAGACAGAGTTGGG + Intergenic
1009999398 6:70933181-70933203 CAATTTTCAGAGGAACAGCTGGG + Intronic
1011416362 6:87123723-87123745 CAATATACACAGAAAATGCTAGG - Intergenic
1012685331 6:102240630-102240652 CTATATACAGAGAGAGTGCTGGG - Intergenic
1012703772 6:102495958-102495980 CAAATGGCAGAGATAGAGCTTGG - Intergenic
1012756920 6:103243318-103243340 ATAAATGAAGAGAAAGAGCTAGG + Intergenic
1012949243 6:105500607-105500629 AAAGATGGAGAGAAAGAACTGGG - Intergenic
1013657053 6:112256890-112256912 GAAGATGAAGAGGAAGAGCTGGG - Intergenic
1014265377 6:119270905-119270927 CAATATTCACAGAAACAGTTGGG - Intronic
1017175613 6:151501674-151501696 AAATATGCAAAGAAAAAGTTTGG - Intronic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1018264388 6:162006618-162006640 TCGTAAGCAGAGAAAGAGCTTGG - Intronic
1018711342 6:166500026-166500048 CAAGATGCAGTCAGAGAGCTTGG + Intronic
1018795978 6:167185999-167186021 GGAAATGCAGACAAAGAGCTTGG + Intronic
1020305586 7:6831612-6831634 AAAAATGCAAAGAATGAGCTGGG - Intergenic
1020406588 7:7842214-7842236 CATTTTACAGAGAAAGAACTGGG - Intronic
1021922107 7:25495781-25495803 CAAGCTGCAGAGACAGAGCGAGG + Intergenic
1023717394 7:43058102-43058124 AAATATGGAGAGAAATAGCTGGG - Intergenic
1024168769 7:46762671-46762693 CAAGATGAATAAAAAGAGCTGGG + Intergenic
1027024999 7:74844846-74844868 AAAAATGCAGAAAATGAGCTGGG - Intronic
1027062765 7:75099273-75099295 AAAAATGCAGAAAATGAGCTGGG + Intronic
1027974461 7:85132989-85133011 CAATATGTATAGAATGAGTTGGG + Intronic
1030620495 7:111785052-111785074 CAATAACAAGAGAAAGAGGTAGG - Intronic
1030673235 7:112360268-112360290 CAATATGCAGAGAAGTAGGCTGG - Intergenic
1031212055 7:118841701-118841723 CAACATGCAGAGAATGAAATTGG - Intergenic
1031517058 7:122713963-122713985 CAATATGTTGACAAAGAGCCTGG + Intronic
1031810808 7:126366470-126366492 AAATGAGCAGAGAGAGAGCTGGG + Intergenic
1031880057 7:127187642-127187664 AATCATGCAGAGAAAGAGCCAGG - Intronic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1032305271 7:130728016-130728038 AAATTTGCAGAGAAAGCACTGGG - Intergenic
1032480039 7:132238987-132239009 CAATTCACAGAGGAAGAGCTGGG + Intronic
1033621893 7:143069347-143069369 CACTAAGCAGAGAAAGGTCTAGG + Intergenic
1041384403 8:57283954-57283976 CTATTTGGACAGAAAGAGCTTGG - Intergenic
1041592222 8:59601424-59601446 CAATCTGCCTAGAAATAGCTAGG + Intergenic
1042455923 8:69002506-69002528 CCATAGGCAGAGCAAGAGCATGG - Intergenic
1044874403 8:96650187-96650209 CATTTTGCAGAGAAAGTGTTTGG + Intronic
1045847247 8:106652237-106652259 CAATTTGCTGAGAGTGAGCTTGG + Intronic
1046761116 8:118022052-118022074 CAATGCGTAGAGAGAGAGCTGGG + Intronic
1046820131 8:118625220-118625242 CAAGATGCTTAGACAGAGCTTGG - Intergenic
1047039522 8:120977411-120977433 CAATACACAGAGAAAGACTTAGG + Intergenic
1047291762 8:123538013-123538035 TAAAATGCAAGGAAAGAGCTTGG - Intronic
1047444889 8:124910826-124910848 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1047714600 8:127584039-127584061 CAAAATGCAGAGACAATGCTGGG - Intergenic
1048206835 8:132422240-132422262 CAATGTGCAGATAAAGAGAAGGG - Intronic
1048376549 8:133827591-133827613 CTTAAAGCAGAGAAAGAGCTAGG + Intergenic
1048778462 8:137974228-137974250 TAAGATGCAAAGAAAGAGCTTGG - Intergenic
1048854810 8:138677323-138677345 GATTATGCAGAGAGAGTGCTTGG + Intronic
1051532967 9:18125875-18125897 CAGTATGCTGAGAAAGGGCAGGG + Intergenic
1051985355 9:23078869-23078891 TAATATACAGAAAAAAAGCTTGG - Intergenic
1053145275 9:35707602-35707624 CAGTCTGAATAGAAAGAGCTTGG + Intronic
1053574209 9:39342243-39342265 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053625296 9:39864654-39864676 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053706880 9:40763940-40763962 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1053838772 9:42170491-42170513 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053879572 9:42578572-42578594 AAATATGAATAAAAAGAGCTAGG - Intergenic
1054095772 9:60900935-60900957 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054117234 9:61176874-61176896 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054218595 9:62386040-62386062 AAATATGAATAAAAAGAGCTAGG - Intergenic
1054232120 9:62523127-62523149 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054416794 9:64884706-64884728 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1054590525 9:67005694-67005716 AAATATGAATAAAAAGAGCTAGG - Intergenic
1055857876 9:80713472-80713494 CTATAAGCAGAAAAAGAGCACGG - Intergenic
1056450052 9:86707967-86707989 CAATGAGAAGAGGAAGAGCTGGG - Intergenic
1056709093 9:88976318-88976340 CACAATGCAGAGAAAGAACAAGG - Intergenic
1056823991 9:89864242-89864264 CAATTTGCACGGCAAGAGCTGGG + Intergenic
1057928594 9:99173841-99173863 CAATATGGTGGGTAAGAGCTTGG - Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1058985104 9:110202785-110202807 CAATGTGCAGAGCAAGAGTGGGG + Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1061295991 9:129677019-129677041 CAAAATGCAGAGCAGGATCTTGG - Intronic
1061467988 9:130798331-130798353 CAAAAGGCAGAGAAAGACATTGG + Intronic
1062551810 9:137091121-137091143 CAATTTGTAGACAAAGACCTTGG - Intronic
1062571462 9:137187650-137187672 CTATATGCAGAGTAAGAGGAAGG - Exonic
1186650096 X:11550122-11550144 CAATATGCAGAGAAAAAGGTTGG + Intronic
1187005414 X:15228308-15228330 CAATATGAAGGGAAAAAGCAAGG + Intergenic
1187631613 X:21179087-21179109 AAAAAGGCAGAGAAAGAGCTAGG + Intergenic
1188194827 X:27220704-27220726 TAATATGCAGAGAAAAATATTGG + Intergenic
1188575613 X:31646386-31646408 TAATATGCATAGAAATAACTTGG + Intronic
1189494495 X:41496836-41496858 CAACATTGAGAGAAAGAGTTGGG - Intergenic
1191260665 X:58316515-58316537 CAATCTGCAAATAAACAGCTGGG + Intergenic
1192199719 X:69058933-69058955 CAATATGCATAGAAAGAAAGAGG + Intergenic
1192485738 X:71524547-71524569 CAAAAAACAGAGAAAAAGCTGGG + Intronic
1192887689 X:75353334-75353356 CAAAAGGCAGAGATAGGGCTGGG - Intergenic
1194550555 X:95292726-95292748 AAATAGGTAGAGAAAGAGATAGG + Intergenic
1195907386 X:109858269-109858291 AAATATGCAGAGATAGAACAAGG - Intergenic
1196609736 X:117697282-117697304 GAGGATGCAGAGAAAGAGATGGG + Intergenic
1197733289 X:129830151-129830173 CAACATACTGAGAAATAGCTAGG - Intronic
1198015753 X:132609055-132609077 CACTATGTAGAGAAAGAGCATGG + Intergenic
1198432414 X:136580837-136580859 CAAGATGCAGATAAATAGGTGGG - Intergenic
1198528398 X:137525110-137525132 CAGCATGAAAAGAAAGAGCTTGG + Intergenic
1198982124 X:142409894-142409916 GAAGAAGGAGAGAAAGAGCTAGG + Intergenic