ID: 1058119113

View in Genome Browser
Species Human (GRCh38)
Location 9:101119147-101119169
Sequence CTGTGGACAAGAACATGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058119113_1058119117 6 Left 1058119113 9:101119147-101119169 CCTTACCATGTTCTTGTCCACAG 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1058119117 9:101119176-101119198 ACATATGTTTAGTACATGAAAGG No data
1058119113_1058119118 9 Left 1058119113 9:101119147-101119169 CCTTACCATGTTCTTGTCCACAG 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1058119118 9:101119179-101119201 TATGTTTAGTACATGAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058119113 Original CRISPR CTGTGGACAAGAACATGGTA AGG (reversed) Intronic
904563140 1:31412198-31412220 CTCTGGACAAGATAATGTTAGGG - Intronic
905056384 1:35097600-35097622 CTATGATCAAGAACAAGGTAGGG - Intronic
911692659 1:100851977-100851999 ATGGGGTAAAGAACATGGTAGGG + Intergenic
913524850 1:119681052-119681074 CTGTGGACAAGGAGATAGTGAGG + Intronic
914666881 1:149840056-149840078 CTGTGGACATGGACAGGGAACGG + Exonic
914668886 1:149853734-149853756 CTGTGGACATGGACAGGGAACGG - Exonic
917481452 1:175415425-175415447 CTGTCAACAAGGACATGGAATGG + Intronic
918818441 1:189222539-189222561 GTATGGACAAGAATATGGTTTGG + Intergenic
921662623 1:217823508-217823530 CTGTGGACAAGGAAATGCCATGG + Intronic
924207608 1:241729529-241729551 CTTTGGAGAAGAATTTGGTAAGG - Intronic
1064390983 10:14942000-14942022 CTGTGGGCAACAACATGGAAAGG - Intronic
1064401347 10:15024009-15024031 CTGTGGGCAACAACATGGAAAGG - Intergenic
1066760120 10:38741605-38741627 CTGGGGTCAGGAATATGGTAGGG - Intergenic
1066961494 10:42231163-42231185 CTGGGGTCAGGAATATGGTAGGG + Intergenic
1067479507 10:46585751-46585773 CTGTGGTGCAGAACATGGAAGGG + Exonic
1067615231 10:47756047-47756069 CTGTGGTGCAGAACATGGAAGGG - Intergenic
1068182026 10:53533412-53533434 CTGTGGGCAAGAACTGGTTAGGG + Intergenic
1068916936 10:62442907-62442929 CAGTGGACTAGAACTTGGTCAGG - Intronic
1070812335 10:79304742-79304764 CTGTGGGCAAGAGGATGGTCTGG + Intronic
1075386442 10:122058768-122058790 CAGTTGACAAGAAGATGCTAAGG + Intronic
1076537565 10:131190794-131190816 CTGAGAACAAGAACAAGATAAGG + Intronic
1079366163 11:19812047-19812069 ATGTGGACAGGACCATGGAAAGG - Intronic
1079412164 11:20199243-20199265 CTGTAAACAAGAAAAGGGTAGGG - Intergenic
1082134059 11:48527340-48527362 CTGTTTACAAGAAAATGCTAAGG + Intergenic
1082567082 11:54693726-54693748 CTGTTTACAAGAAAATGCTAAGG + Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083916303 11:65745982-65746004 CTGTGGGCAAAAGCATGGTGAGG - Intergenic
1085014983 11:73168135-73168157 CTGTGGTCAAGCACATCTTATGG - Intergenic
1085995616 11:81909229-81909251 CTGTGGTTAAGAACATGCAACGG + Intergenic
1087861381 11:103161917-103161939 GTATGGACATGCACATGGTAAGG - Intronic
1088608578 11:111555363-111555385 CTGTGGGAAAGAACAAAGTAGGG - Intronic
1088815265 11:113416512-113416534 ATGTGCACATGAACATGGGATGG - Intronic
1088899456 11:114104201-114104223 CTGAAGAGAAGAACATGGTTAGG - Intronic
1089034353 11:115370515-115370537 CTTTGGACATGAACATGTGATGG - Intronic
1090118480 11:124000114-124000136 ATGTGGATAAGGACATGGAAAGG + Intergenic
1093031369 12:14292114-14292136 CTGAAGATAAGAACATGTTAGGG + Intergenic
1093342074 12:17989637-17989659 CTGGGGACTAGAACAGAGTAAGG - Intergenic
1096748732 12:53745360-53745382 GAGTGGACAAGGACATGGGAAGG + Intergenic
1100615692 12:96230030-96230052 CTGTGGACCAGAACATTATGTGG - Intronic
1104541296 12:129667959-129667981 CTGTGGATAACAACATTTTAGGG - Intronic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1106892778 13:34264107-34264129 CTGCAGAGAAGAACTTGGTACGG + Intergenic
1109237962 13:59847660-59847682 CTGTGTACATGTACATGGGAGGG + Intronic
1109759260 13:66805601-66805623 CAGTGGACAAGTACCTGGTTGGG - Intronic
1110646204 13:77887643-77887665 CTGTGCAAAATATCATGGTAAGG + Intergenic
1112661580 13:101515372-101515394 CTTTAGACAACAAGATGGTAGGG + Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1120523391 14:85549939-85549961 CTGTGGTCAAGAAGAAGATAAGG + Intronic
1123844142 15:24280166-24280188 CTGTAGATATGAACATGGTATGG - Intergenic
1123859223 15:24446449-24446471 CTGAAGATATGAACATGGTATGG - Intergenic
1124065082 15:26334959-26334981 CTCTGGACTAGAAAATGGGAAGG + Intergenic
1125505710 15:40266420-40266442 CAGTGGACAGGAACATGCTTCGG - Exonic
1126714373 15:51498687-51498709 CTTTGGCCAAGAACATGCAAGGG - Exonic
1128472879 15:67970022-67970044 CTGTGCAGAAGAACATGCAAAGG - Intergenic
1133176193 16:4016494-4016516 CTAGGGACAAGAACACGGTCTGG - Intronic
1134013823 16:10874648-10874670 TTGTGGACAAGAACTGGGTCTGG + Intergenic
1134812761 16:17181402-17181424 TTCTGGACAAAAACATGGTCTGG - Intronic
1137643918 16:50058258-50058280 CTGAGCACAAGTACATGGTGTGG - Intergenic
1144078271 17:11738326-11738348 CTGTGGCTAAGAGCATGGGAGGG - Intronic
1144352539 17:14411601-14411623 CTGTAGAGAAGTACTTGGTATGG + Intergenic
1145876524 17:28322584-28322606 GTTTGGATAAGAACATGGTAAGG + Intronic
1146891094 17:36506957-36506979 TGGTGGAGAAGAACAAGGTACGG - Exonic
1147239803 17:39083303-39083325 CTTGGGACAAGAACATGGCCTGG - Intronic
1148337266 17:46850470-46850492 CAGTGGACACCAGCATGGTAGGG - Intronic
1148487182 17:47998008-47998030 CTGAGGACATGAACAGGGTTGGG + Intergenic
1150435584 17:65151832-65151854 CAGTGGCCAGGAAGATGGTAAGG - Intronic
1151851664 17:76694213-76694235 CTCAGGACAAGCACATGGTAGGG - Intronic
1152382408 17:79948931-79948953 CTGTGGACAAAGACGTGGTCCGG - Exonic
1153235211 18:2979705-2979727 CTGTGGACATGAATATGTTTCGG - Intronic
1153822686 18:8845661-8845683 CTGTGGTTAAGAACAATGTACGG + Intergenic
1156879935 18:42064927-42064949 CTGTGGGCAGGAACAAGGAAGGG - Intronic
1160361415 18:78285004-78285026 CTGTGTACCTGGACATGGTATGG - Intergenic
1163639907 19:18456306-18456328 CTGTGGACCAGCACAGGGTTGGG + Intronic
1164088238 19:21923695-21923717 CTGTGGGCTAGACCATGGCAAGG - Intergenic
925324104 2:3003103-3003125 ATGTGCATAAGAACATGGGAAGG - Intergenic
926447515 2:12961945-12961967 TTGGGGTCAAGAACCTGGTAAGG + Intergenic
927030909 2:19119560-19119582 CTGTGGACAGGAACATGGGTGGG + Intergenic
928072136 2:28227625-28227647 CTGTGGACAACAGGAAGGTAAGG - Intronic
929127181 2:38532753-38532775 CTGTGGAGAAGAGGATGGGAGGG - Intergenic
930627222 2:53711261-53711283 CTGTGGGCCAGAGAATGGTAGGG - Intronic
930938106 2:56981234-56981256 GTTTGGGCAGGAACATGGTAAGG + Intergenic
937373052 2:121315757-121315779 CTGATATCAAGAACATGGTAAGG + Intergenic
939119007 2:138093416-138093438 CTATGGAATAGAACAGGGTAAGG - Intergenic
941614779 2:167707039-167707061 CTGTGGAGAGAAACATGGAAAGG + Intergenic
943540621 2:189209267-189209289 CTGTGGATTAGAAAATGGAATGG + Intergenic
944082144 2:195799877-195799899 CTGTGGAAAAGAAGAAGGAAAGG + Intronic
947253977 2:228141074-228141096 CAGCGGAAAATAACATGGTATGG - Intronic
948467075 2:238157810-238157832 CTGTGAACCAGGACAGGGTAAGG + Intergenic
1169201076 20:3710508-3710530 CAGTGGCCAAGAACCTGGTGTGG - Intergenic
1169856738 20:10111253-10111275 CTGTGGATAGGCACATGGCATGG - Intergenic
1170264668 20:14451744-14451766 CTGTGTGCAAGAAAGTGGTAAGG + Intronic
1170343582 20:15356886-15356908 CTGTGAAGAAGAACATGTTATGG + Intronic
1172489829 20:35327134-35327156 CTGTGGAGAAGAAGAAGGCAGGG - Intronic
1173046647 20:39518919-39518941 CTATGGAAAAAGACATGGTACGG + Intergenic
1176376235 21:6088141-6088163 CCGAGGACAAGCACATGGAACGG + Intergenic
1176890880 21:14317619-14317641 CAGTGAACAAGAAAAAGGTAAGG + Intergenic
1176980704 21:15377678-15377700 CTGTGGAGATAAACATGGCAAGG + Intergenic
1177048508 21:16201839-16201861 CTCTAGCCAAGAACATGCTAGGG - Intergenic
1177175787 21:17699598-17699620 CTGTGGACAAAAAAATGCAAAGG + Intergenic
1179747240 21:43450103-43450125 CCGAGGACAAGCACATGGAACGG - Intergenic
1180550191 22:16531817-16531839 CTGGGGTCAGGAATATGGTAGGG - Intergenic
1183032107 22:35113988-35114010 CTGAGGACAAGAACATGGACAGG + Intergenic
950890549 3:16400397-16400419 CTGTCGAGTAGAACATGGCAAGG - Intronic
950966111 3:17147059-17147081 CTGTGGACAAGGAGACGCTATGG + Intergenic
951015307 3:17725434-17725456 CTGTGGGCAAGAGCATAGCAGGG + Intronic
951260929 3:20507439-20507461 TTTTAGACAAGAACATGGTAAGG - Intergenic
951455528 3:22888177-22888199 CTATTGGCAAGCACATGGTATGG + Intergenic
951591969 3:24276064-24276086 CTGTCTACAAGAGCATGGAAAGG - Intronic
954803082 3:53198712-53198734 CTGAGGACAGGACCAGGGTAGGG - Intergenic
956970942 3:74524590-74524612 GTGTAGACAAGTACTTGGTATGG + Intergenic
957472161 3:80672103-80672125 ATGTGGACAAATACATGGAAGGG - Intergenic
960208823 3:114935190-114935212 TAGTTGCCAAGAACATGGTAGGG - Intronic
960247043 3:115411375-115411397 CTGTGGGCAAGAACCAGGGAAGG + Intergenic
962567358 3:136675176-136675198 CTGGGGACAAGATAGTGGTAAGG - Intronic
967842118 3:194014303-194014325 ATATGAACAAGAACATGGTGAGG + Intergenic
969538467 4:7770964-7770986 ATGGGGACAAGAGCATGGTGGGG - Intronic
970050487 4:11908899-11908921 CTTTGGAGAAGAAGTTGGTATGG - Intergenic
970373498 4:15432977-15432999 CTGTGAAGAAGAATGTGGTAAGG - Intronic
970477870 4:16442164-16442186 CAGTGGACGAGGAGATGGTAAGG + Intergenic
972015867 4:34244775-34244797 TTGAGGACAAGAACAGGGTCAGG - Intergenic
975465167 4:74700667-74700689 CTGTGGAGATGAACACGGGAGGG + Intergenic
976836003 4:89374655-89374677 CTGAGGACAAGAACATTATAGGG - Intergenic
978366216 4:107985585-107985607 CTGCAGAGAAGAACTTGGTATGG - Intergenic
978371212 4:108031180-108031202 TTGTGGAGAAGAAGATAGTAAGG + Intronic
980084190 4:128374670-128374692 CTGGGGTCAAGAGCATGGAAGGG + Intergenic
983410578 4:167392070-167392092 CTTTGGACAAGAATATGCAAGGG + Intergenic
984051970 4:174875514-174875536 CTGTAGAAAAGAACATTGTGTGG - Intronic
984585619 4:181560887-181560909 TTGTGGACAACAACAAGGGAGGG + Intergenic
992838489 5:80664027-80664049 CTGTGTTCTAGTACATGGTAGGG + Intronic
992988448 5:82257881-82257903 CTGTGGGCAAGCACATGCCAAGG + Intronic
993422191 5:87716342-87716364 CTATGGACAACAACATTTTAGGG + Intergenic
995138677 5:108708006-108708028 CTGTGGGCAGGAACATAGAAAGG - Intergenic
996015009 5:118523643-118523665 CAGTGCTCAAGGACATGGTAAGG - Intergenic
997777307 5:136622152-136622174 CTGAAGACAAGAACATGATCAGG - Intergenic
998992222 5:147830347-147830369 CTGTGGATAAGTTCATGGAAGGG + Intronic
999211477 5:149893226-149893248 CGGTAGAGAAGAACTTGGTATGG - Intronic
999367337 5:151031696-151031718 CTGGAGCCAAGAACAAGGTAGGG - Intronic
1003256709 6:4481622-4481644 ATGTGGAGAGGAACATGGTGTGG + Intergenic
1004232083 6:13842838-13842860 CTGTGGGCAACTATATGGTATGG + Intergenic
1004328221 6:14696742-14696764 CAGTGTTCCAGAACATGGTAAGG + Intergenic
1005895445 6:30173398-30173420 CTGTGTACAAGAACACTTTAGGG + Intergenic
1007376609 6:41461211-41461233 CTGTGCTTAAGAACATGGTGGGG - Intergenic
1008302387 6:49857096-49857118 CTGAGGACTAGGACATGGCAGGG - Intronic
1013648048 6:112164401-112164423 CTGAGGACAAGATCTGGGTATGG + Intronic
1015294101 6:131570742-131570764 CTGTTCACAAGGACATCGTAAGG - Intergenic
1017876171 6:158525977-158525999 CTGTGGGCAGGAAAATGGTAAGG - Intergenic
1020255843 7:6502873-6502895 CTGTGGACAAGAAGGTGGGTAGG + Intronic
1020992406 7:15216282-15216304 CTGTGGACAAGAACAGAGACAGG - Intronic
1021928478 7:25555981-25556003 CTGTAGACAAAAACTTGGCATGG + Intergenic
1022577512 7:31512201-31512223 CTGTGGACAACACTATTGTAAGG + Intergenic
1022794295 7:33719688-33719710 CTTTGGACCAGATCCTGGTATGG + Intergenic
1025138949 7:56446915-56446937 CTGAGGAGAAGAAGATGGAAAGG - Intergenic
1026242298 7:68587143-68587165 CTGTGGACAGGTACAAGGAAAGG - Intergenic
1026744312 7:72999150-72999172 CTGTGGGCAGGAACATGGAAGGG - Intergenic
1027030418 7:74883823-74883845 CTGTGGGCAGGAACATGGAAGGG - Intergenic
1027099425 7:75365942-75365964 CTGTGGGCAGGAACATGGAAGGG + Intergenic
1027831888 7:83187373-83187395 CTGAGGAAAGGAAGATGGTATGG + Intergenic
1029174652 7:98656019-98656041 ATGGGGACAAGAACATGTCAGGG + Intergenic
1029378679 7:100198465-100198487 CTGTGGGCAGGAACATGGAAGGG + Exonic
1031070782 7:117159348-117159370 CTATGGGGAAGAACATGGGATGG - Intronic
1032483236 7:132263214-132263236 CTGTGGAAAGGAACCTGGCATGG + Intronic
1037838973 8:22230816-22230838 CTGTGGACATGAACATGTCTGGG - Intronic
1040817487 8:51524071-51524093 CTGTGGACAAGCCCATCGTATGG - Intronic
1045396082 8:101761943-101761965 CTGAGGAGAACAACATAGTAGGG + Intronic
1045398117 8:101782594-101782616 CTGGAGTCAAGAACATGGTTGGG - Intronic
1046166904 8:110448962-110448984 CTGTGGAGAAGAACACGTGAGGG - Intergenic
1046238622 8:111461490-111461512 CTGTAGAAAAGAACCTGCTATGG + Intergenic
1047225267 8:122951269-122951291 CTGTGGACAAGAACAAAGACAGG - Intronic
1047809341 8:128391275-128391297 CTGGGGTAAAGAACAAGGTAGGG - Intergenic
1048203073 8:132392857-132392879 CTGTGGACTAAAATATGATATGG - Intronic
1048257388 8:132915412-132915434 CTGTCAACAAGAAGATGGGAGGG + Intronic
1050217362 9:3341700-3341722 ATGTGGAAAAGACCATGGAAGGG - Intronic
1055836601 9:80450221-80450243 CAGTGGAGAAGAAGTTGGTAGGG - Intergenic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1062036217 9:134383792-134383814 CTATGGACAAGGGCATGGGACGG - Intronic
1188002391 X:24994797-24994819 CTGTGTTCAGGAACCTGGTAAGG - Intronic
1189528906 X:41857815-41857837 CTGTGGACAAGGAGATTGTCAGG + Intronic
1191013256 X:55783499-55783521 CTGTGTAGAAGAGCATGGTTGGG - Intergenic
1194111624 X:89841093-89841115 CTGTGGAAAAAAATATGGAATGG + Intergenic
1195454109 X:105049072-105049094 CTGCAGGCAAGACCATGGTAAGG - Intronic
1200443494 Y:3236989-3237011 GAGTGGACAAGATTATGGTACGG + Intergenic
1201190853 Y:11440932-11440954 CTGGGGTCAGGAATATGGTAGGG - Intergenic
1202072245 Y:21004290-21004312 CTGTAGACAAGACCCAGGTAGGG + Intergenic