ID: 1058120475

View in Genome Browser
Species Human (GRCh38)
Location 9:101133146-101133168
Sequence TGGATCAAAGTGGGTATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058120475_1058120479 1 Left 1058120475 9:101133146-101133168 CCATCAATACCCACTTTGATCCA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1058120479 9:101133170-101133192 AAAATTTCCTTTACCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058120475 Original CRISPR TGGATCAAAGTGGGTATTGA TGG (reversed) Intronic
900771900 1:4552072-4552094 TGGAGCAAAGTGGGTCTTCATGG - Intergenic
902415118 1:16233910-16233932 TGGATTAATGTTGTTATTGAGGG + Intronic
903385775 1:22925197-22925219 TGGCTGAAAGTGGGTGTTTATGG - Intergenic
905272072 1:36793787-36793809 TGGATAAAAGGGGGGATGGATGG + Intergenic
910517687 1:88081605-88081627 TGGATCAAAATGGAATTTGATGG - Intergenic
913109797 1:115647724-115647746 AGGATCAGAGAGGGTGTTGAAGG + Intronic
913478360 1:119260728-119260750 TGGAAGAAATTGGGTAGTGAGGG + Intergenic
913587351 1:120288553-120288575 AAGAACAAAGTGGGTATGGATGG + Intergenic
913620834 1:120609816-120609838 AAGAACAAAGTGGGTATGGATGG - Intergenic
914569366 1:148900436-148900458 AAGAACAAAGTGGGTATGGATGG + Intronic
914603460 1:149229820-149229842 AAGAACAAAGTGGGTATGGATGG - Intergenic
914908725 1:151767967-151767989 TGAAGCAAGGTGGGCATTGATGG - Intronic
916915501 1:169402015-169402037 TTGATCAAATTGGCTACTGAAGG - Intronic
922203689 1:223428640-223428662 TGGATGAATGTTGTTATTGATGG - Intergenic
922400490 1:225249257-225249279 TGGATCAAGGTGGGTGATGGTGG + Intronic
923655076 1:235908978-235909000 TGGCTCAGAGTGTGTGTTGAAGG + Intergenic
1065393717 10:25211528-25211550 TGGATTAATGTGGTTATTAAGGG - Intronic
1071218049 10:83430560-83430582 AGGAAAAAAGTGGGTATTAAGGG + Intergenic
1072930373 10:99657474-99657496 TGAAGCAGAGTGGGGATTGAGGG + Intergenic
1074501384 10:114028058-114028080 TCAAACAAAGTGGGAATTGAGGG + Intergenic
1077763957 11:5136644-5136666 AGAATAAAACTGGGTATTGAGGG + Intergenic
1078952623 11:16152205-16152227 TGGATAAAAGTGACTATTTAAGG - Intronic
1079048705 11:17133335-17133357 TGGATTTAAATGGATATTGATGG - Intronic
1079862363 11:25689300-25689322 TGTGTGAAAGTAGGTATTGAGGG + Intergenic
1079869274 11:25776263-25776285 TGTCTTAAAATGGGTATTGATGG + Intergenic
1080429686 11:32186642-32186664 AGGATCCAAGTGGCAATTGAAGG - Intergenic
1086357301 11:86016442-86016464 AGGATCAATGTGGGTAGTGGTGG - Intronic
1086791299 11:91041638-91041660 TGGAGCAGAATGGATATTGAGGG + Intergenic
1086998448 11:93386978-93387000 TAGATCAAATAGTGTATTGAAGG - Intronic
1088845857 11:113666293-113666315 TTAATGAAAGTAGGTATTGAAGG + Intergenic
1089627736 11:119762291-119762313 TGGACCATAGTGGGTCTTCAAGG + Intergenic
1090507019 11:127326791-127326813 TTGAACAACGTGGGTATTAAGGG - Intergenic
1092941619 12:13413956-13413978 TCTATCAAACTGGGTATAGAAGG + Intergenic
1096709057 12:53442192-53442214 AGGAACCAAGTAGGTATTGAGGG + Intronic
1098242014 12:68477649-68477671 TGGATCAAAGTGAGAGTGGAAGG - Intergenic
1098678930 12:73325579-73325601 TTAATCAAACTTGGTATTGAAGG + Intergenic
1099963447 12:89418954-89418976 TGGATCATGGTGGGAAATGAAGG + Intergenic
1099998337 12:89804639-89804661 TGGATTAAAGCCGTTATTGAGGG + Intergenic
1101458565 12:104864064-104864086 AGGATCCAAGGGGGTATTGGAGG - Intronic
1103579365 12:121902919-121902941 GGCATTAAATTGGGTATTGAAGG + Intronic
1104179278 12:126362764-126362786 TAGAATAAAGTGGGTATGGATGG + Intergenic
1106624383 13:31405551-31405573 TGGATTAAAGAGAATATTGACGG + Intergenic
1108114064 13:47108776-47108798 TGGAGCAAAGGGGGTATCGCTGG - Intergenic
1109118952 13:58429175-58429197 TGCAGCTAAGTGTGTATTGAAGG + Intergenic
1111031837 13:82610423-82610445 TTGATCAAAGTGGGTAAGGAAGG - Intergenic
1111424598 13:88063403-88063425 TTGAACAATGTGGGTATTAAGGG - Intergenic
1114695783 14:24626528-24626550 TGGATACAAGTGTGTACTGAGGG - Intergenic
1116137274 14:40943199-40943221 TGGATAAAAGTAGATATTTAGGG - Intergenic
1120203139 14:81560083-81560105 TGGATCAAAGAAGATATTGAGGG + Intergenic
1120387733 14:83866913-83866935 TGGAGCAAAGTGGGTAATCATGG + Intergenic
1122041662 14:98992132-98992154 AGGAGAAAAGTGGGTATTAAAGG - Intergenic
1122263139 14:100534574-100534596 AGGATCACAATGGGTGTTGAAGG - Intergenic
1124160378 15:27263057-27263079 TTGACCTAAGTGGGTTTTGATGG - Intronic
1126894945 15:53247876-53247898 TGGATCACAGTGCCTACTGAAGG + Intergenic
1126959689 15:53977874-53977896 TAAATCAAAGTGGGAAATGATGG - Intergenic
1127377352 15:58397485-58397507 TGGATCAAAGTGGGCAGAGCTGG - Intronic
1129631954 15:77270097-77270119 TGGAATAAATTAGGTATTGATGG + Intronic
1130207624 15:81892196-81892218 TTGAACAAAGTGGGGATTGGAGG + Intergenic
1130423835 15:83775407-83775429 AGGATGAAAGTGGTTATTCATGG - Intronic
1131171152 15:90179199-90179221 TGGATCTAAGTGGGTAAGAAGGG + Intronic
1131470499 15:92692625-92692647 TGCAACAAACTGGGTATGGAAGG + Intronic
1131728119 15:95249668-95249690 TGGGTAAAAGTGGGCCTTGAGGG + Intergenic
1133572283 16:7053286-7053308 TGGAGGAAAGTGGGTAGAGAGGG - Intronic
1133586618 16:7201860-7201882 TAGATCAGAGGGAGTATTGATGG + Intronic
1136117889 16:28106905-28106927 TGGTTGAAAGTGGATAATGAAGG + Intronic
1137420639 16:48330610-48330632 GGAATCAAAGTGGGTATTCTAGG + Intronic
1142626136 17:1193276-1193298 TGAATCCTTGTGGGTATTGAGGG - Intronic
1145960705 17:28885120-28885142 TGCATCAAATAGAGTATTGAAGG + Intronic
1146370392 17:32262519-32262541 TGGATCAAACTCGGTTTAGAAGG - Intergenic
1148542842 17:48493640-48493662 TGAATCAGAGTGGGTACTGCAGG + Intergenic
1149123003 17:53192509-53192531 TGAGTTAAAGTAGGTATTGAAGG - Intergenic
1151068619 17:71182078-71182100 TTGATTAAACTGGGTATTAAAGG - Intergenic
1151352013 17:73537408-73537430 GGGAACAAAGTGGGAATCGAAGG - Intronic
1153807546 18:8722234-8722256 TGGAACAACGTGGGGATTGGAGG + Intronic
1159253950 18:65921285-65921307 TGGATCTAAGTGCATATTAATGG + Intergenic
1159435276 18:68408488-68408510 GGGATGAAAGTGTGTATGGATGG + Intergenic
1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG + Intronic
1165566732 19:36735926-36735948 CTCATCAAAGTGGGTATAGAAGG + Intronic
1165774193 19:38395330-38395352 TGGAGAAAAGTGGGGATTGAGGG + Intronic
925268697 2:2586354-2586376 TGGATCAAGGTGGATTCTGAAGG + Intergenic
926762656 2:16292387-16292409 TGGAGCAAAGTGGGTCTTTGTGG + Intergenic
927303107 2:21538497-21538519 TTCATCAAAGTGGGTATAGAGGG + Intergenic
927372376 2:22371304-22371326 TAGATCAAAGTGGATGTGGAGGG + Intergenic
927797929 2:26067807-26067829 TGCATCAAAATAAGTATTGATGG - Intronic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
929390828 2:41466578-41466600 TGGATAAAAGTGGGATTTGGAGG + Intergenic
929989784 2:46777115-46777137 TGGATCAAAATGAGAATTCATGG - Intergenic
930638061 2:53827781-53827803 TGAATAAAGGTGGATATTGAGGG - Intergenic
931553268 2:63470639-63470661 TGGATCACTGTAGCTATTGATGG - Intronic
932991392 2:76792359-76792381 TGGAGGAAAGTGGTTATAGAAGG + Intronic
933648885 2:84833102-84833124 TGCATCAAAGGGGGTGTTCATGG + Intronic
937634224 2:124137929-124137951 TGAATCATAGTGGGTAATGAAGG - Intronic
940837494 2:158539698-158539720 TGGATCTCAGTGGTTTTTGAGGG + Intronic
941137808 2:161739211-161739233 TGGATAAAAGAGGGTAGCGAAGG - Intronic
941590017 2:167408336-167408358 CTCATCAAAATGGGTATTGAAGG + Intergenic
941860646 2:170276155-170276177 TGGGTGAAAGTGGGTATAGGTGG - Intronic
946862633 2:224014710-224014732 AGGAACAAAGTGGGTTTTGTTGG - Intronic
947120539 2:226810240-226810262 TAGAGAAAAGTGAGTATTGACGG + Intergenic
947831960 2:233147754-233147776 TGGATCACACTGGGTCTTGGTGG - Intronic
1170292469 20:14785862-14785884 TGGAACAAAGAGGTGATTGATGG - Intronic
1176976499 21:15327169-15327191 TGGAACAAAGTGGGAACTCACGG + Intergenic
1182093753 22:27612888-27612910 TGCTTCAAAATGGTTATTGAAGG + Intergenic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
950421398 3:12901726-12901748 TTGACCAAAGTGGGGAGTGAGGG + Intronic
951168360 3:19508520-19508542 AGGATCACAGTGGGAATTAATGG + Intronic
951205513 3:19922336-19922358 TGGTTGAAAGTGTGTATTCAGGG + Intronic
953088056 3:39692934-39692956 TTCAACAAAGTGGGTATAGAAGG + Intergenic
953828847 3:46278011-46278033 TTGATCCAAGGGGGAATTGATGG + Intergenic
955575954 3:60363677-60363699 TGGAGCAGAGTGGGGAGTGATGG - Intronic
955927091 3:64017772-64017794 TGGAGAAAAGTGGGAATGGACGG - Intronic
957577716 3:82031136-82031158 TGGAACAAAGAGGCCATTGAAGG - Intergenic
958273297 3:91537311-91537333 TATATCCAAGTGGGTATTTAGGG - Intergenic
958616950 3:96506195-96506217 TGGGTGAAATTGGGGATTGAGGG - Intergenic
961841609 3:129718952-129718974 TTGATCAAAGTGGGGATTAGGGG - Intronic
962341346 3:134586973-134586995 TTGATCGAATTGGCTATTGAAGG + Intergenic
962549336 3:136473347-136473369 TGGACCAAGGTGGGGGTTGAGGG - Intronic
965547592 3:169931889-169931911 TGGACCAATGTGTGTAATGATGG + Intronic
968815515 4:2819689-2819711 TGGATTTAAGTGGGCAATGAGGG + Intronic
969506661 4:7592210-7592232 TGGATGAAAGTGGGTAGTTGGGG - Intronic
970139722 4:12968715-12968737 AGGACGAAACTGGGTATTGATGG + Intergenic
975460614 4:74649155-74649177 TGGATCAGAATGGGTATTCTAGG - Intergenic
977575967 4:98674391-98674413 TGGATCATAATGGGTAAAGATGG - Intergenic
977624489 4:99175505-99175527 TAGATCAAATTGGCTACTGAAGG + Intergenic
978470633 4:109063519-109063541 TGGATAAAAGAGGGTAAGGAAGG + Intronic
980730944 4:136823876-136823898 TGGATCATAGTGGGAATTTGTGG - Intergenic
982842864 4:160214160-160214182 TTGCTTAAATTGGGTATTGATGG - Intergenic
987209683 5:15667907-15667929 TGGATCAAAGAGGTGATTCAAGG - Intronic
989327463 5:40215849-40215871 TGCTTAAAAGTGGGAATTGAGGG + Intergenic
992512783 5:77456038-77456060 TAGATCAATGTGGGTAGTGGTGG + Intronic
994384204 5:99109925-99109947 TCGATCATAGTTGGTATTGATGG + Intergenic
994593899 5:101806967-101806989 TGGATCAGAGTGAGAATTGATGG + Intergenic
995812479 5:116123170-116123192 TGGAATAAACTAGGTATTGATGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999008702 5:148010824-148010846 TAAATCAATGTGTGTATTGATGG - Intergenic
999125944 5:149245792-149245814 TGAATCAGAGTGGATCTTGATGG - Intronic
1000266278 5:159641085-159641107 TGGAACAGAGTGGGAATTTATGG + Intergenic
1000826032 5:166044893-166044915 TGGATTAATGTTGTTATTGAGGG - Intergenic
1003563322 6:7201959-7201981 TAGATAAAAGTGGCTATAGACGG + Intronic
1004230200 6:13826195-13826217 TGGATTAATGTTGTTATTGAGGG - Intergenic
1005109074 6:22258844-22258866 TGGACCTATGTGGGTAATGAAGG + Intergenic
1006097400 6:31664690-31664712 AGGAGCAAAGTCGGTATTGTAGG - Intronic
1012442202 6:99270926-99270948 TGGATAAAAGTGGATTTTGGAGG - Intergenic
1013711455 6:112904917-112904939 TGGATGAAAGTAGGTATGAATGG + Intergenic
1013915287 6:115329887-115329909 TGAATAAAAGTGAATATTGAGGG - Intergenic
1014307236 6:119757963-119757985 TGACTCAAAGTGGGCTTTGATGG + Intergenic
1017415967 6:154221042-154221064 TGTATCAAAGTGGCTATTTCGGG - Intronic
1018981664 6:168606419-168606441 GGTATCAAAGAGGCTATTGAGGG + Intronic
1023693469 7:42818919-42818941 TGAAACAAAGTGGGTCTTTAGGG - Intergenic
1032485515 7:132284452-132284474 TGGATTAAAAGGGGTTTTGAGGG + Intronic
1032876593 7:136044947-136044969 TGAGTCAAAGTGGGAAATGAGGG + Intergenic
1033864860 7:145677210-145677232 TGGATTAAAGTTGTTATTGAGGG + Intergenic
1035252395 7:157605856-157605878 TGGATCAGAGTGGGAACTCATGG - Intronic
1035372199 7:158386665-158386687 TGGATAAGATTGGGGATTGAAGG - Intronic
1038142890 8:24865605-24865627 TGGAAGAAAGTGAGTTTTGAGGG - Intergenic
1038345426 8:26727850-26727872 TGGATAAAAGTGCGGATGGAGGG + Intergenic
1042645161 8:70979017-70979039 TTGATCAAATTGGCTACTGAAGG + Intergenic
1042712555 8:71734559-71734581 TTCATCAAAGTCAGTATTGAAGG - Intergenic
1042787900 8:72569769-72569791 TGGATTTAAGTGAGTATTGTGGG + Intronic
1042790048 8:72595192-72595214 TGGAACAGAGTGGGAAATGATGG - Intronic
1043414810 8:80036108-80036130 TGGATGAAGGTGGGTATTGGGGG - Intronic
1044389906 8:91637818-91637840 TGTTTCAAAGTAGATATTGAAGG - Intergenic
1047792598 8:128219848-128219870 TGGATCACAGGGGGTCTTGTAGG + Intergenic
1048754513 8:137722081-137722103 TGGAGCAAAGAGGGTTTTTAGGG + Intergenic
1057768246 9:97942602-97942624 TAGAACAAACTAGGTATTGAGGG + Intronic
1057778368 9:98029061-98029083 TGGAACACAGTGGGTATTTAGGG - Intergenic
1058120475 9:101133146-101133168 TGGATCAAAGTGGGTATTGATGG - Intronic
1059361923 9:113750770-113750792 TGGATCAAAGTTGTTATAAAAGG + Intergenic
1059721878 9:116967863-116967885 TGGATCACATTGTGCATTGATGG - Intronic
1061604395 9:131697953-131697975 TGGAACAAAGTGGGGCGTGAAGG + Intronic
1185750505 X:2607179-2607201 TGGATGAAAGGGGGGATAGACGG - Intergenic
1187762447 X:22602780-22602802 TGCAACAAACTGGGTATGGAAGG - Intergenic
1189365081 X:40381750-40381772 TGGATCACAGGGGATATTTAGGG - Intergenic
1192018200 X:67354928-67354950 TGGCTGAAAGTGGGTTATGATGG - Intergenic
1195672051 X:107477966-107477988 AGGATCTAGGTGGGTCTTGAAGG - Intergenic
1197094614 X:122578504-122578526 TGGATCAAAGTGTGGACAGAAGG - Intergenic
1199861102 X:151801189-151801211 TGGATCAGAGTGGGGACTTATGG - Intergenic
1202075770 Y:21036729-21036751 AGGAGAAAAGTGGGTATTAAAGG + Intergenic