ID: 1058123781

View in Genome Browser
Species Human (GRCh38)
Location 9:101168365-101168387
Sequence AACATCCCATATCATATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058123781 Original CRISPR AACATCCCATATCATATCTA TGG (reversed) Intronic
909135699 1:71797399-71797421 AATATCCAATATGAAATCTAAGG + Intronic
909137656 1:71821653-71821675 AAAATACCATATGATATCTGTGG + Intronic
909317678 1:74245090-74245112 AAAATCTCACATAATATCTACGG + Intronic
910801026 1:91146233-91146255 AACATGACATATCAAACCTATGG - Intergenic
911135985 1:94440967-94440989 TACATCTCATACCATATGTAAGG + Intronic
911769278 1:101718814-101718836 AACATCTCAAATCAGATCAAAGG + Intergenic
912490463 1:110060024-110060046 AACATCCAATATCATTTCCATGG + Exonic
918584056 1:186165290-186165312 AACATCCCATTTGACAGCTAAGG + Intronic
920187897 1:204173170-204173192 AACATCACATAGCAAATTTATGG - Intergenic
922022658 1:221719918-221719940 ACCATATCATATCATATATATGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064891250 10:20176178-20176200 AATATACAGTATCATATCTAAGG - Intronic
1066424335 10:35292263-35292285 AAAATCCCAAATCATTTCTTGGG - Intronic
1069268428 10:66493048-66493070 AAAAGCACAGATCATATCTAGGG + Intronic
1073253812 10:102138360-102138382 AGCATCCCACATCTTATCTGAGG + Intronic
1076804566 10:132849017-132849039 AACAACATAAATCATATCTAAGG + Intronic
1078901416 11:15646072-15646094 AACATCACATTTCATATAGATGG + Intergenic
1080576490 11:33604169-33604191 ATTATCTCATATCATATCTGTGG + Intronic
1081114344 11:39180643-39180665 AACGTCCCATAATACATCTATGG - Intergenic
1082904294 11:58289751-58289773 AACATAGCATAGCATATATAGGG + Intergenic
1085764673 11:79272512-79272534 CACATCTCGTATTATATCTATGG + Intronic
1088350015 11:108875686-108875708 AACATCTAATATAATAACTAAGG + Intronic
1088943200 11:114481570-114481592 AACAACACAGATCATATTTAAGG + Intergenic
1090882595 11:130847169-130847191 AACATCCCAGAAAGTATCTAGGG - Intergenic
1092081186 12:5717737-5717759 AACATCCAAGATCAGATCAATGG - Intronic
1096787180 12:54023815-54023837 AGCTTCCCCCATCATATCTATGG + Intronic
1096935972 12:55276746-55276768 TAAATCCCATATCAGATATAAGG - Intergenic
1098221066 12:68270420-68270442 GTCATCTCATATCATTTCTAAGG + Intergenic
1098888289 12:75982507-75982529 AACAACACATATCATATAAAGGG + Intergenic
1099535267 12:83835637-83835659 AACATCCTATCTCATATCTCAGG + Intergenic
1100011805 12:89962568-89962590 AACCTCCCACCTCATATATAAGG + Intergenic
1100093444 12:91001555-91001577 AACATGTCATATCAGATTTATGG + Intronic
1105896814 13:24723602-24723624 AACTGCCCAGATCATTTCTAAGG - Intergenic
1106052719 13:26206616-26206638 AACATCTGATATTATTTCTATGG + Intronic
1107532576 13:41298222-41298244 AATATCCCATACCCTACCTAAGG - Intergenic
1107900522 13:45008885-45008907 ATCATCCCATTTCAACTCTAAGG + Intronic
1108398268 13:50011523-50011545 AACATACCATTTCATATTTGTGG + Intronic
1109981305 13:69912144-69912166 AAGACCCCATATTATATATATGG - Intronic
1111136526 13:84052516-84052538 AACATCCCATAGAATATCCTTGG - Intergenic
1112733244 13:102390240-102390262 AATATTCCATATCTTAACTAGGG + Intronic
1113259334 13:108544304-108544326 CACTTCTCATCTCATATCTAAGG - Intergenic
1115213308 14:30989862-30989884 ATCATCCCATTTCATAGATATGG - Intronic
1117496825 14:56313754-56313776 CACATCCCAAACCATATCGATGG - Intergenic
1120226019 14:81791617-81791639 AACATCAGAAATCTTATCTATGG - Intergenic
1123385126 15:19788535-19788557 AACATTCCATATCATAGCCCAGG - Intergenic
1125142545 15:36425920-36425942 TACGTACCATATCATAGCTAGGG - Intergenic
1128398999 15:67257566-67257588 AACATGCCATAGCCTATTTAAGG - Intronic
1131697485 15:94893848-94893870 GACATGCCTTATCATCTCTATGG + Intergenic
1133895777 16:9927609-9927631 AACATCCTAACTCACATCTAAGG + Intronic
1135273303 16:21087216-21087238 AAAGTCCTGTATCATATCTAAGG - Intronic
1139029388 16:62860606-62860628 AACATGCCATGTCAGATGTATGG - Intergenic
1203102322 16_KI270728v1_random:1319414-1319436 AACATCAAATGTGATATCTAGGG + Intergenic
1150926253 17:69535292-69535314 AACCCCCCATAACATTTCTAAGG - Intronic
1156608870 18:38702469-38702491 AAAATCCCAGAAAATATCTAGGG - Intergenic
1156785577 18:40909992-40910014 AAGATCCCATCTCATAACAAAGG - Intergenic
1158982014 18:62772448-62772470 AGGATCCCATAACATATCTTGGG + Intronic
1159036484 18:63283281-63283303 AACATTCCATGTCACCTCTACGG + Intronic
1159760279 18:72417200-72417222 AACATGCCACATCATATCGGAGG - Intergenic
925766695 2:7243256-7243278 TACATCTCATATCTTATCTGTGG - Intergenic
925798838 2:7576208-7576230 AAAATGCCATATCATGGCTAAGG - Intergenic
930031998 2:47064038-47064060 AACATCCCTTATTGCATCTAGGG - Intronic
931312172 2:61092460-61092482 AACATCCCATGTCTTATCTCTGG - Exonic
931561753 2:63569417-63569439 AACAACACATAACATATATAAGG - Intronic
933631659 2:84666132-84666154 CACAGCCAATATCATATCAAAGG + Intronic
935517089 2:104053324-104053346 AAAATCCAATAGCATATCTATGG + Intergenic
936693145 2:114916400-114916422 AAGATCTCATACCAAATCTATGG + Intronic
938795579 2:134716367-134716389 ACCAGCCCACATCATTTCTAAGG + Intronic
938953046 2:136274524-136274546 AAAATCCCTTATCAGATATATGG - Intergenic
938989470 2:136613001-136613023 AACATCCTCTAACACATCTATGG + Intergenic
940566077 2:155362209-155362231 AAAATACCATATCCAATCTATGG - Intergenic
940738798 2:157483088-157483110 AACATCACAGATCAGATATAAGG - Intronic
942652738 2:178185550-178185572 AACATCTCCTATCAGATGTATGG - Intergenic
942877633 2:180820631-180820653 ATTATCCCATTTCACATCTATGG - Intergenic
946586444 2:221193151-221193173 AACATAACATATCAAAACTATGG + Intergenic
1170465475 20:16618850-16618872 AACATCAAAAATCCTATCTATGG - Intergenic
1174617620 20:51848190-51848212 AACATCTCATGTCATCTCCAGGG + Intergenic
1177958802 21:27635774-27635796 AACATTCCATATCTTATTTGTGG - Intergenic
1181994744 22:26868266-26868288 AATATGCCATATCACATTTATGG + Intergenic
949309515 3:2680985-2681007 AAAATGCAATATCATATCTATGG + Intronic
951625580 3:24659082-24659104 AACATCACACATCACATCTATGG - Intergenic
951683600 3:25320777-25320799 AAGAACCCAAATCATATCTCTGG - Intronic
951870585 3:27357132-27357154 AAAATCCAATATCAAATGTATGG + Intronic
953768849 3:45763690-45763712 GACATCCCATAGCACATCCATGG + Intronic
953972077 3:47355666-47355688 AACATCCTAAGTCATTTCTAGGG - Intergenic
955757667 3:62241924-62241946 ACCATCCAGTATCATAGCTAAGG - Intronic
957174499 3:76788662-76788684 GATATTCCATATCATTTCTATGG - Intronic
957398077 3:79670163-79670185 AATATCCTATATCTTATTTATGG - Intronic
957855345 3:85869514-85869536 GAAATCCCATATGAGATCTATGG - Intronic
959429019 3:106229101-106229123 AAACTCCCATATCTTTTCTAAGG + Intergenic
960254727 3:115499707-115499729 GACATCCCATCTCTTTTCTAGGG + Intergenic
960929420 3:122829765-122829787 AACATCACATTTCACTTCTAGGG + Intronic
961635872 3:128332099-128332121 AACATACAATAACATATATATGG - Intronic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
965331745 3:167383351-167383373 AACATCCTATTACATATGTATGG + Intergenic
965952072 3:174321646-174321668 AAAATCCCTTATCACATATATGG - Intergenic
970768285 4:19578131-19578153 ACTATCCCTTATCATATTTACGG - Intergenic
972029584 4:34436879-34436901 AATATTCCATAACATACCTAGGG + Intergenic
973054535 4:45639238-45639260 AACATTCCATTTAATATCTCAGG - Intergenic
974139874 4:57872145-57872167 ATCATCCTAGATAATATCTACGG + Intergenic
975056694 4:69941846-69941868 GACTAGCCATATCATATCTATGG - Intronic
980569950 4:134601379-134601401 CACATCACATAAAATATCTAGGG + Intergenic
983157780 4:164372652-164372674 AACATTCAATCTCATATCTGAGG - Intronic
983962105 4:173767626-173767648 AACATCCTATGTCATATTTCTGG + Intergenic
984310089 4:178046862-178046884 AACATCCCTTATTATTCCTATGG - Intergenic
985310721 4:188595291-188595313 AACAAACCTTATCATTTCTATGG - Intergenic
986697087 5:10366988-10367010 ATCATATCATATCATATCAAGGG - Intronic
989189427 5:38655571-38655593 AACATTGCATCTCATATATAAGG - Intergenic
989486685 5:41998663-41998685 AACATCCCCTCTCATATTAAGGG - Intergenic
990157938 5:52900790-52900812 AACAACCCAAATGATATATATGG - Intronic
991659203 5:68933108-68933130 AACAGACTATATCATATGTAAGG - Intergenic
995744894 5:115393194-115393216 AAGATCCCATAGCACTTCTAGGG - Intergenic
1008630894 6:53362226-53362248 AAAATCCCAAATCATCGCTATGG + Intergenic
1010288550 6:74108592-74108614 GAAAACCCATAACATATCTATGG + Intergenic
1011292883 6:85794754-85794776 AACATCCCAAATCCTCTCTATGG + Intergenic
1013902353 6:115172404-115172426 AAAATCACACATCATATGTAAGG + Intergenic
1014626399 6:123731197-123731219 ATTATCTCATATTATATCTATGG + Intergenic
1015389322 6:132663459-132663481 AACATACAATATCTTCTCTATGG - Intergenic
1025805681 7:64831270-64831292 AACATACCAAAACATATCTGTGG - Intronic
1027699776 7:81455719-81455741 GAGAGCACATATCATATCTAAGG - Intergenic
1029213747 7:98930154-98930176 AACATCAAATATCACAGCTAGGG - Exonic
1040056362 8:43061118-43061140 AAAATCCCATATGAAATGTATGG - Intronic
1042209505 8:66365793-66365815 ACCATCTTATATCATATATATGG + Intergenic
1042249668 8:66743370-66743392 ACCAGTCCATATCCTATCTATGG + Intronic
1046039078 8:108880175-108880197 CACATGCCATATAATATATATGG - Intergenic
1050968302 9:11836452-11836474 ATCATCCCATATAAAATCTTTGG + Intergenic
1051919339 9:22246303-22246325 AACATCGCATATTATATATGGGG + Intergenic
1055267981 9:74520299-74520321 AAGAGCCCATATTATATTTATGG + Intronic
1058123781 9:101168365-101168387 AACATCCCATATCATATCTATGG - Intronic
1189678161 X:43485822-43485844 AACATCCCATATCAAAATTGTGG + Intergenic
1190394722 X:49969440-49969462 AACATACCATATCAAAAATAGGG - Intronic
1194314804 X:92363903-92363925 AACATACCTCATCATATCAATGG - Intronic
1200362436 X:155622905-155622927 AAAATGCAATATCATATGTATGG - Intronic
1200622856 Y:5475418-5475440 AACATACCTCATCATATCAATGG - Intronic