ID: 1058123876

View in Genome Browser
Species Human (GRCh38)
Location 9:101169534-101169556
Sequence GCTTTCTTCTCAACTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058123872_1058123876 16 Left 1058123872 9:101169495-101169517 CCCTTCCCATTAGTTTATTTTGA 0: 1
1: 0
2: 1
3: 50
4: 533
Right 1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG No data
1058123873_1058123876 15 Left 1058123873 9:101169496-101169518 CCTTCCCATTAGTTTATTTTGAC 0: 1
1: 0
2: 1
3: 35
4: 299
Right 1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG No data
1058123875_1058123876 10 Left 1058123875 9:101169501-101169523 CCATTAGTTTATTTTGACATTAT 0: 1
1: 0
2: 3
3: 53
4: 631
Right 1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG No data
1058123874_1058123876 11 Left 1058123874 9:101169500-101169522 CCCATTAGTTTATTTTGACATTA 0: 1
1: 0
2: 1
3: 45
4: 647
Right 1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058123876 Original CRISPR GCTTTCTTCTCAACTGCTTC AGG Intronic
No off target data available for this crispr