ID: 1058125460

View in Genome Browser
Species Human (GRCh38)
Location 9:101189109-101189131
Sequence CACTTTGAGCACATGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1760
Summary {0: 1, 1: 7, 2: 74, 3: 600, 4: 1078}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058125460_1058125465 10 Left 1058125460 9:101189109-101189131 CCTCAGAACATGTGCTCAAAGTG 0: 1
1: 7
2: 74
3: 600
4: 1078
Right 1058125465 9:101189142-101189164 AGCTTGGTTTCATACATTTTAGG 0: 22
1: 699
2: 1369
3: 1240
4: 1009
1058125460_1058125464 -6 Left 1058125460 9:101189109-101189131 CCTCAGAACATGTGCTCAAAGTG 0: 1
1: 7
2: 74
3: 600
4: 1078
Right 1058125464 9:101189126-101189148 AAAGTGGTCAGGGTGAAGCTTGG No data
1058125460_1058125466 11 Left 1058125460 9:101189109-101189131 CCTCAGAACATGTGCTCAAAGTG 0: 1
1: 7
2: 74
3: 600
4: 1078
Right 1058125466 9:101189143-101189165 GCTTGGTTTCATACATTTTAGGG 0: 22
1: 700
2: 1316
3: 1187
4: 1032

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058125460 Original CRISPR CACTTTGAGCACATGTTCTG AGG (reversed) Intronic
900033609 1:389035-389057 CACCTTGGACACATGTTCTCAGG + Intergenic
900054444 1:618925-618947 CACCTTGGACACATGTTCTCAGG + Intergenic
900721163 1:4176691-4176713 CACCTTGGGCACCTGTTCTCAGG + Intergenic
900757580 1:4447442-4447464 CACCTTGGGCACATGTCCTCAGG + Intergenic
901460867 1:9390849-9390871 CACCTTGGGCACAGGTTCTCAGG + Intergenic
902429887 1:16354683-16354705 CACCTTGGGCACATGTTCTCAGG + Intronic
902662049 1:17911438-17911460 CACCTTGAGCACATGTCGTCAGG + Intergenic
902978281 1:20105110-20105132 CACCTCGGGCACATGTTCTCAGG - Intergenic
903309490 1:22443264-22443286 CACCTTGGGCACATGTTCTGAGG - Intergenic
903393671 1:22982937-22982959 CACGTTGGGCACATGTTGTCAGG - Intergenic
904394563 1:30210085-30210107 CACCTTGGGCACATGTTCTCAGG + Intergenic
904712199 1:32438721-32438743 CACCTTGGGCACATGTTTTCAGG + Intergenic
907657270 1:56356997-56357019 CACCTTGAGCACGTGTTGTCAGG - Intergenic
907897448 1:58705012-58705034 CACCTTGGGCACATGTTGTCAGG + Intergenic
908239656 1:62178089-62178111 CACCTTGGGCACATGTTCTCAGG + Intergenic
908574296 1:65442493-65442515 CACCTTGGGCACATGTTCTCAGG + Intronic
908662151 1:66448369-66448391 CACATTGGGCACATGTTCTCAGG + Intergenic
908748611 1:67398807-67398829 CACTTTGGGCACATGTCCTCCGG - Intergenic
908817946 1:68052729-68052751 CACCTTGGACACATGTTCTCAGG + Intergenic
908910161 1:69063858-69063880 CACCTTGGGCACATGTTCTCAGG - Intergenic
909443200 1:75720719-75720741 CACCCTGAGCACATGTTCTCAGG - Intergenic
909684280 1:78329100-78329122 CACCTTGGGCACATGTTCTTAGG + Intronic
909857030 1:80548053-80548075 CACCTTGAGCACATGTTCTCAGG + Intergenic
910195907 1:84639422-84639444 CACTTTGGGCACATGTCATCAGG - Intergenic
911023584 1:93413164-93413186 CACCTTGGGCATATGTTCTCAGG - Intergenic
911107654 1:94149057-94149079 TACCTTGGGCACATGTTCTAAGG - Intronic
911167188 1:94734775-94734797 CACCTTGGGCACAGGTTCTCAGG + Intergenic
911784753 1:101932400-101932422 CACTATGAGCAGATCTTCGGAGG + Intronic
911937322 1:103994215-103994237 CACTTAGAGCACATTTTATTTGG + Intergenic
912346311 1:108966303-108966325 CACCTTGGGCACATCTTCTCAGG + Intergenic
912346424 1:108967365-108967387 CACCTTGGGCACATGTTCTCAGG - Intergenic
912388997 1:109288673-109288695 CACTTTGGGCACATGTTGTCAGG + Intergenic
912563089 1:110564190-110564212 CACCTTGGGCACATGTTGTCAGG - Intergenic
912629934 1:111238205-111238227 CACCTTGGGCACATGTCCTCAGG + Intronic
912938709 1:114025893-114025915 CACCTTGGGCACATGTTCTCAGG + Intergenic
912940307 1:114039035-114039057 CACCTTGGGCACATGTTCTCAGG + Intergenic
913173657 1:116254830-116254852 CACCTTGGGCACATGCTCTCAGG + Intergenic
913517920 1:119620843-119620865 CACTTTTAGCAAAGTTTCTGTGG - Exonic
913669142 1:121079028-121079050 CACCTTGAGTACATGTTCTCAGG + Intergenic
914020887 1:143866425-143866447 CACCTTGAGTACATGTTCTCAGG + Intergenic
914659384 1:149774367-149774389 CACCTTGAGTACATGTTCTCAGG + Intergenic
914886923 1:151593148-151593170 CACCTTGGGCACATGTTCTCAGG - Intergenic
914886964 1:151593446-151593468 CACTTTGGGCACATGTTCTCAGG + Intergenic
915074348 1:153296516-153296538 CACGTTGGGTACATGTTCTCAGG + Intergenic
915208587 1:154288939-154288961 CACTTTGTGCACAGGTTCTCAGG - Intergenic
915256558 1:154635570-154635592 CACCTTGGGCACATGTTGTCAGG - Intergenic
915642102 1:157235837-157235859 CACTTTGGACACATGTTCTCAGG + Intergenic
915652400 1:157325617-157325639 CACATTGGGCACATGTCCTCAGG + Intergenic
915672434 1:157501619-157501641 CACCTTAGGCACATGTTCTTAGG - Intergenic
915767832 1:158384182-158384204 CACTTTAAAGACATTTTCTGGGG + Intergenic
915880573 1:159667102-159667124 CACCTTGTGCACATGTTCTCAGG - Intergenic
915892845 1:159787630-159787652 CGCCTTGGGCACATGTTCTCAGG - Intergenic
916145150 1:161731713-161731735 CAAATTAGGCACATGTTCTGAGG + Intergenic
916226772 1:162496931-162496953 CACCTTGGGTACATGTTCTCAGG - Intergenic
916951255 1:169782459-169782481 CACCTTGGGCACATGTTTTCAGG + Intronic
917097945 1:171418278-171418300 CACCTTGGGCATATGTTCTCAGG - Intergenic
917150916 1:171943736-171943758 CACCTTGGGCACATGTTTTCAGG + Intronic
917152980 1:171964557-171964579 CACCTTGGGCACATGTTCTCAGG + Intronic
917210152 1:172622955-172622977 CACCTTGGGCACATGTTCTCAGG - Intergenic
917310664 1:173674477-173674499 CACCTTGGGCACATGTTATCAGG - Intergenic
917409865 1:174748511-174748533 CACCTTGGGCACATGTTCTCAGG - Intronic
917530686 1:175832367-175832389 CACCTTGGGTACATGTTCTCGGG - Intergenic
917556114 1:176090309-176090331 CACCTTGGGCACATGTTCTCAGG + Intronic
918005219 1:180535489-180535511 CACTTTGGGCACATGTTGTTAGG - Intergenic
918061593 1:181066178-181066200 CACCTTGGGCACATGTTCTCAGG + Intergenic
918540950 1:185632452-185632474 CACCTTGAGCACATGTTATCAGG + Intergenic
918542458 1:185647498-185647520 CACCTTGGGCCCATGTTCTCAGG - Intergenic
918720060 1:187841298-187841320 CACCTTGGGCACATGTTGTTAGG - Intergenic
918767852 1:188511650-188511672 CACCTTGGGCACATGTTCTCAGG + Intergenic
919503601 1:198369438-198369460 CACTTTGGGGACATGTTCTCAGG + Intergenic
920106562 1:203557411-203557433 CACTTTACGCACCTGTTTTGAGG - Intergenic
920795380 1:209131766-209131788 CACCTTGGGTACATGTTCTCAGG + Intergenic
921230686 1:213067185-213067207 CACCTTGGGCACATGTTGTCAGG + Intronic
921776137 1:219102336-219102358 CACCTTGGGCACATGTTTTCAGG + Intergenic
921776449 1:219105846-219105868 CACGTTGGGCACATGTTTTCAGG - Intergenic
922166271 1:223118060-223118082 CACCTTGGGCACATGTTCTCAGG - Intronic
922166580 1:223120509-223120531 CACCTTAGGCACATGTTCTCAGG + Intronic
922202989 1:223422382-223422404 CACCTTGGGCACATGTTCTCAGG - Intergenic
922236985 1:223729497-223729519 CACCTTGGGCACAGGTTCTCAGG - Intronic
922255968 1:223893190-223893212 CACCTTGGACACATGTTCTCAGG + Intergenic
922337478 1:224629384-224629406 CACCTTGGGCACATGTTCTCAGG + Intronic
922609759 1:226917226-226917248 CACCCTGGGGACATGTTCTGAGG + Intronic
922694476 1:227721763-227721785 CATTTTGGGCACATGTTCTCAGG + Intergenic
922758746 1:228110980-228111002 CACCTTGGGAACATGTTCTCAGG - Intergenic
922813633 1:228433363-228433385 CACCTTGGGCACATGTTCTCAGG + Intergenic
923074765 1:230600514-230600536 CACCTTGAGCATGTGTTCTCAGG - Intergenic
923328717 1:232902869-232902891 CACCTTGGGTACATGTTCTCAGG - Intergenic
923384577 1:233453784-233453806 CACCTTGGGTACATGTTCTGAGG + Intergenic
923755982 1:236791599-236791621 CACCTTGGGCACCTGTTCTCAGG + Intergenic
923804009 1:237238453-237238475 TACCTTGAACACATGTTCTCAGG + Intronic
924272517 1:242348694-242348716 CACCTTGGGCACATGGTCTCAGG - Intronic
924337168 1:242996057-242996079 CACCTTGGACACATGTTCTCAGG + Intergenic
924852442 1:247843962-247843984 CACCTTAAGCACATATTCTCAGG + Intergenic
924924685 1:248667964-248667986 CACATTGGGCACATATTCTCAGG + Intergenic
924929648 1:248717927-248717949 CACCTTGGGCACATGTTGTCAGG + Intergenic
924931055 1:248732844-248732866 CACCTTGGGCACATTTTCTCAGG + Intronic
924938148 1:248789793-248789815 CACCTTGGGCAAATGTTCTCAGG - Intergenic
1062953297 10:1521914-1521936 CACCTTGGACACATGTTCTCAGG + Intronic
1063018533 10:2102609-2102631 CACTTTGGGGACATCTTCTCAGG - Intergenic
1063102760 10:2964673-2964695 CACCTTGGACACATGTTCTCAGG + Intergenic
1063106958 10:3000521-3000543 CACTTTGGGCACATGTCTTCAGG - Intergenic
1063432956 10:6007039-6007061 CACCTTGGTCACATGTTCTCAGG + Intergenic
1063510662 10:6642326-6642348 CACCTTGAGCACATGTCATCAGG + Intergenic
1063845296 10:10121148-10121170 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1064098724 10:12444491-12444513 CACCTTGGGCACATGTTCACAGG - Intronic
1064174698 10:13064490-13064512 CACCTTGGGCACATGTCGTGAGG - Intronic
1064628805 10:17287932-17287954 CACCTTGGGCACATGTTTTCAGG + Intergenic
1064804748 10:19118309-19118331 CACCTTGGGCACCTGTTCTCAGG - Intronic
1065156183 10:22872407-22872429 CACCTTGGGCACATGTTCTCAGG + Intergenic
1065265624 10:23972091-23972113 CACTTTGGGTACATGTTCTCAGG + Intronic
1065838802 10:29683033-29683055 CACCTTAAGCACATGTTCTCAGG - Intronic
1065847270 10:29756051-29756073 CACCTTGAGCACATGTTCTCAGG + Intergenic
1065888563 10:30100799-30100821 TACCTTGGGCACATGTTCTCAGG - Intronic
1066054264 10:31665858-31665880 CACCTTGGGCACATGTTGTCAGG - Intergenic
1066192973 10:33072700-33072722 CACCTTGGGCACATGTTCTCAGG + Intergenic
1066195637 10:33096988-33097010 CACCTTGGGCACATGTTCTCAGG - Intergenic
1066712150 10:38247448-38247470 CACCTTGGGCACATGGTCTCAGG + Intergenic
1067143304 10:43674383-43674405 CACATTGTGTACATATTCTGTGG + Intergenic
1067266002 10:44745777-44745799 CACCTTGGGCACATGTTCTCAGG - Intergenic
1067856245 10:49796058-49796080 CACCTTGGGCACATGTTCTCAGG - Intergenic
1068040695 10:51820445-51820467 CATCTTGAGCACCTGTTGTGTGG + Intronic
1068111939 10:52690285-52690307 CACCTTGGGTACATGTTCTCAGG - Intergenic
1068152593 10:53152442-53152464 AGCTTTGAGCACAAGTTCTTTGG - Intergenic
1068366138 10:56052369-56052391 CACCTTGGGCACATGTTTTCAGG + Intergenic
1068436077 10:56992688-56992710 CAATTTGAATCCATGTTCTGCGG - Intergenic
1068438453 10:57020195-57020217 CACCTTGGGCACAAGTTCTCAGG - Intergenic
1068505323 10:57893145-57893167 CACCTTGGACACATGTTCTCAGG - Intergenic
1068685678 10:59868009-59868031 CACCTTGAGCACATGTCATCAGG + Intronic
1068718962 10:60220761-60220783 CACCTTGGGCACAGGTTCTCAGG + Intronic
1069048415 10:63766713-63766735 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1069119025 10:64545006-64545028 CACCTTGGGCACATGTTCTCAGG + Intergenic
1069134881 10:64751657-64751679 CACCTTGGGCACATGTTCTCAGG - Intergenic
1069170815 10:65226494-65226516 CACCTTGGGAACATGTTCTCAGG + Intergenic
1069180634 10:65354126-65354148 CACCTTGGGCACATGTTCTCAGG + Intergenic
1069273728 10:66564014-66564036 CACCTTGGGCACATGTTGTCAGG + Intronic
1069329764 10:67278314-67278336 CACCTTGGGCACATGTTCTCTGG - Intronic
1069925851 10:71850545-71850567 CACCTTAGGCACATGTTCTCAGG + Intronic
1070171902 10:73939295-73939317 CACCTTGGGCACATGTTCTCAGG + Intergenic
1070255564 10:74810844-74810866 CACCTTGGGCACATGTTCTCAGG - Intergenic
1070573274 10:77657811-77657833 CACCTTGGGCACATGTTCTGAGG - Intergenic
1070581216 10:77721205-77721227 CACCTTGGGCACATGTTGTCAGG - Intergenic
1070905425 10:80068238-80068260 CACCTTGGGCACATGTTCTCAGG + Intergenic
1070991513 10:80737140-80737162 CACCTTGGGCACATGTTCTCAGG + Intergenic
1071012154 10:80952026-80952048 CACCTTGGGCACATGTTGTCAGG + Intergenic
1071032152 10:81197467-81197489 CACCTTGGGTACATGTTCTCAGG + Intergenic
1071074015 10:81730053-81730075 CACCTTGGGCACATTTTCTCAGG - Intergenic
1071235719 10:83645962-83645984 CATCTTGAGCACATGCTCTTAGG - Intergenic
1071426923 10:85566524-85566546 CACCTTGGGCACATGTTCTCAGG + Intergenic
1071863112 10:89696195-89696217 CACCTTGTGCACATGTTCTCAGG + Intergenic
1071897156 10:90080130-90080152 TACTTTGAGCACATGTTGTCAGG + Intergenic
1071898572 10:90092589-90092611 CACCTTGGGCACATGTCCTCAGG + Intergenic
1071926758 10:90417977-90417999 CACCTTGGGCACATGTTCTCAGG + Intergenic
1072357087 10:94622500-94622522 CACTTTGGGCACATGTCATTAGG - Intergenic
1072357731 10:94628069-94628091 CACCTTGGGAACATGTTCTTAGG + Intergenic
1072385665 10:94924906-94924928 GACTTTGACCACATGTTATCAGG - Intergenic
1072480034 10:95802059-95802081 CACCTTGGGCACATGTTCTCAGG - Intronic
1073395689 10:103215514-103215536 CACCTGGGGCACATGTTCTCAGG - Intergenic
1073548555 10:104375645-104375667 CACTTTGGGCACATGTTCTCAGG - Intronic
1073560993 10:104496765-104496787 CACCTTGGGCATATGTTCTCAGG - Intergenic
1073926972 10:108527811-108527833 CACCTTGGGCACATGTTCTCAGG + Intergenic
1073995065 10:109306309-109306331 CACCTTGGGCACATGTTCTCAGG - Intergenic
1074002194 10:109384377-109384399 CACCTTGGGCACATGTTCTCAGG + Intergenic
1074215126 10:111376731-111376753 CACGTTGGGCACATGTTCTCAGG - Intergenic
1074228001 10:111506199-111506221 CACCTTGGACACATGTTCTCAGG - Intergenic
1074986434 10:118664051-118664073 CACTTTGAGATCCTGTTCTCTGG + Intergenic
1075190224 10:120300315-120300337 CACCTTGGGCACATATTCTCAGG + Intergenic
1075243708 10:120801381-120801403 CACTTTGGGGACATGTTTTCAGG + Intergenic
1075243794 10:120802005-120802027 CACCTTGGGCACATGTTGTCAGG - Intergenic
1076293805 10:129368211-129368233 CCCTTGGAGACCATGTTCTGAGG - Intergenic
1076324680 10:129611977-129611999 CACCTTAGGCACATGTTCTCAGG - Intronic
1076653000 10:132002948-132002970 CACCTTGGACACATGTTCTCAGG + Intergenic
1076977391 11:184622-184644 GACTTTGGGCACATGTTCTCAGG + Intronic
1077038151 11:505135-505157 CACCTTGGGCACATGTTCCCAGG + Intronic
1077559150 11:3246413-3246435 CACCCTAAGCACATGTTCTTGGG - Intergenic
1077593041 11:3507700-3507722 CACCTTAAGCACATGTTGTCAGG + Intergenic
1077671159 11:4158808-4158830 CACCTTGGGCACATGTTCTCAGG - Intergenic
1077763890 11:5135853-5135875 TACCTTGGGCACATGTTCTCAGG + Intergenic
1077809360 11:5621945-5621967 CACCTTGGGCACATGTTGTCAGG + Intronic
1077885699 11:6386160-6386182 CACCTTGGGCACATGTTCTCAGG - Intergenic
1078046607 11:7918985-7919007 TACCTTGGGCACATGTTCTCAGG + Intergenic
1078359596 11:10658115-10658137 CACTTTCAGCAGATCTCCTGTGG - Intronic
1078403295 11:11046266-11046288 CACCTTGGGCACATGTTCCCAGG - Intergenic
1078536367 11:12178361-12178383 TACTTTGGGCACATGTTCTCAGG - Intronic
1079163740 11:18017257-18017279 TACCTTGGGCACATGTTCTCAGG + Intergenic
1079229940 11:18641041-18641063 CACCTTGGGCACATGTTCTGAGG - Intergenic
1079483952 11:20914234-20914256 CACCTTGGGCACATGTCCTCAGG - Intronic
1079675799 11:23224900-23224922 CACCTTGAGCACATGTTCTCAGG - Intergenic
1079696863 11:23492341-23492363 CACCTTAGGCACATGTTCTCAGG + Intergenic
1079726581 11:23887042-23887064 CATCTTGGGCACATGTTCTCAGG + Intergenic
1079805471 11:24924646-24924668 CACCTTGAGCACACATTCTCAGG - Intronic
1079884667 11:25972394-25972416 CACCTTGGGCACATGTTGTCAGG - Intergenic
1079891016 11:26053260-26053282 CACCTTGGGCACATGTTCTCAGG - Intergenic
1079893674 11:26091633-26091655 CACTTTGGGCACATGTTCTTGGG - Intergenic
1080045241 11:27801083-27801105 CACCTTGGACACATGTTCTTAGG - Intergenic
1080072193 11:28102484-28102506 CACTTTGGGCACATGCTCTCAGG + Intronic
1080777598 11:35400854-35400876 CCCCTTGGGCACATGTTCTCAGG - Intronic
1080867598 11:36209275-36209297 CAGTTTTAGCAGTTGTTCTGTGG + Intronic
1080873290 11:36255747-36255769 CTCCTTGGGCACATGTTCTCAGG - Intergenic
1080950513 11:37026899-37026921 TACGTTGGGCACATGTTCTTAGG + Intergenic
1081185365 11:40035796-40035818 CACCTTGGACACATGTTCTCAGG + Intergenic
1081236923 11:40657742-40657764 CACCTTGGGCACATGTTGTCAGG + Intronic
1081328757 11:41778582-41778604 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1082689527 11:56282773-56282795 CACCTTGGGCACATGTTGTCAGG - Intergenic
1082701949 11:56442742-56442764 CACCTTGAGCACATGTTCTCAGG - Intergenic
1082825376 11:57573985-57574007 CAGTTTGAGCCCATGTTCAAGGG + Intergenic
1082846242 11:57728062-57728084 CACCTTGGGCACATGTTCTCAGG + Intronic
1082846662 11:57731531-57731553 CACCTTGGGCACATATTCTCAGG + Intronic
1082950600 11:58811090-58811112 CACTTTGGGCACATGTTGTCAGG + Intergenic
1083055067 11:59811452-59811474 CACCTTGGGCACATGTTCTCAGG - Intergenic
1083096533 11:60256536-60256558 CACCTTGGGCACATGTTCCGAGG + Intergenic
1083105890 11:60358422-60358444 AGCCTTGAGCACATGTTCTCAGG - Intronic
1083239578 11:61377445-61377467 CACCTTGAGCACATATTGTCAGG + Intergenic
1083539625 11:63503493-63503515 CACCTTAGGCACATGTTCTCAGG + Intergenic
1083539763 11:63504521-63504543 AACCTTGAGCACACGTTCTCAGG + Intergenic
1083633814 11:64109466-64109488 CACCGTGAGCACAGCTTCTGGGG + Intronic
1084025536 11:66446366-66446388 CACCTTGGGCACATGTTGTCAGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084248875 11:67880420-67880442 CACCTTAAGCACATGTTGTCAGG + Intergenic
1084606609 11:70175998-70176020 CACCTTGGGCCCATGTTCTCAGG - Intronic
1084635885 11:70392288-70392310 CACCTTGGGCCCATGTTCTCAGG + Intergenic
1084801144 11:71545001-71545023 CACCTTGGGCCCATGTTCTCAGG + Intronic
1084823941 11:71715050-71715072 CACCTTAAGCACATGTTGTCAGG - Intergenic
1084874707 11:72122632-72122654 CACCTTGGGCACATGTTGTCAGG - Intronic
1084893078 11:72245989-72246011 CACTTTGAGCTATAGTTCTGTGG + Intergenic
1084933104 11:72572412-72572434 CACCTTGGGCACATGTTCTCAGG - Intergenic
1085486807 11:76871334-76871356 CACCTTAGGCACATGTTCTCAGG - Intronic
1085619352 11:78026083-78026105 CACCTTGGGCACATGACCTGAGG - Intronic
1085831155 11:79902153-79902175 CACCTTGGGCACATATTCTCAGG + Intergenic
1085988662 11:81813186-81813208 CACCTTGGGCACATGTTCTCAGG + Intergenic
1086127556 11:83364884-83364906 CACCTTGGGCACATGTTGTCAGG - Intergenic
1086203896 11:84235284-84235306 CATCTTGGGCACATGTTCTCAGG + Intronic
1086272449 11:85083490-85083512 CACCTTGGGCACATGTTCTCAGG - Intronic
1086287720 11:85268488-85268510 CACCTTGGGCACATGTCCTCAGG + Intronic
1086390491 11:86358233-86358255 CACCTTGGGCACATGTTCTCAGG + Intergenic
1086416896 11:86597755-86597777 CACTTTGGTCACATGTTGTGAGG - Intronic
1086501930 11:87462605-87462627 CACCTTGAGCACATGTTCTCAGG - Intergenic
1086856935 11:91876768-91876790 CACCTTGGGCACATGTTCTCAGG + Intergenic
1086963691 11:93006431-93006453 CACCTTGGGCACATGCTCTCAGG + Intergenic
1087226458 11:95606311-95606333 CACCTTGGGCACAAGTTCTCAGG - Intergenic
1087389078 11:97511995-97512017 CACCTAGGGCACATGTTCTAAGG - Intergenic
1087900204 11:103631909-103631931 CACTTTGGGCCCATGTTCTCAGG + Intergenic
1088087118 11:105994725-105994747 CACCTTGGGCACATGTTCTCAGG - Intergenic
1088129331 11:106468029-106468051 CACCTTGGGCACATGTTCTCAGG + Intergenic
1088212889 11:107475773-107475795 CACCTTGGGCACATGTTCCTAGG + Intergenic
1088313817 11:108487332-108487354 CACCTTGAGCACAGGTTCTCAGG + Intronic
1088561858 11:111123244-111123266 CATCTTGGGCACATGTTCTCAGG + Intergenic
1088727460 11:112652333-112652355 CACCTTGGGCACATGTTGTCAGG - Intergenic
1088877795 11:113950310-113950332 CACCTTGGGCACATGTTCTCAGG + Intergenic
1088948634 11:114541538-114541560 CACCTTGGGCACATGTTCTCAGG - Intronic
1089044777 11:115491010-115491032 CACTTTTAGAACATAGTCTGAGG + Intronic
1089144753 11:116317924-116317946 CATTTTGAGGCCATGTTATGAGG - Intergenic
1089144807 11:116318502-116318524 CATTTTGAGGCCATGTTATGAGG - Intergenic
1089864113 11:121616832-121616854 CACCTTGGGCACATGTTCTCAGG - Intronic
1090096918 11:123751538-123751560 CACCTTAGGCACATGTTCTCAGG - Intergenic
1090100259 11:123787984-123788006 CACTTTAGGCACATGTTGTCAGG - Intergenic
1090108416 11:123876744-123876766 CACCTTGGGCACATGTTCTCAGG + Intergenic
1090825527 11:130382774-130382796 CACCTTGGGCACATGTTCTCAGG - Intergenic
1090877651 11:130805270-130805292 CACCTTGGGCACATGTTCTCAGG + Intergenic
1090921852 11:131213762-131213784 CACCTTGGGCACATGTTGTCAGG + Intergenic
1091242343 11:134062261-134062283 CACCTTGGGCACCTGTTCTCAGG + Intergenic
1091257133 11:134198490-134198512 CACCTTGGGCACATGTTCTCAGG + Intronic
1091574556 12:1721128-1721150 CACCTTGAGCACATGTTGTCAGG + Intronic
1092304148 12:7282331-7282353 CACCTTGGACACATGTTCTCAGG + Intergenic
1092499528 12:9031653-9031675 CACCTTGGGCACATGTTCCCAGG - Intergenic
1092613754 12:10197742-10197764 CACCTTGGGCACATGTCCTCAGG + Intergenic
1092645764 12:10570282-10570304 GACCTTGGGCACATGTTCTCAGG + Intergenic
1093298584 12:17423870-17423892 AACTGTTAGCACATGTTCTGAGG - Intergenic
1093513140 12:19952215-19952237 CACTTTGAATGCATGTTGTGTGG - Intergenic
1093624776 12:21332136-21332158 CACCTTGAACACATGTTTTTAGG - Intronic
1093708555 12:22302999-22303021 CACCTTGGGCACATGTTGTCAGG + Intronic
1093932054 12:24963850-24963872 CACCTTGAGCACATGTTGCCAGG + Intergenic
1094018413 12:25887821-25887843 CACCTTGGGCACATGCTCTCAGG + Intergenic
1094089178 12:26629223-26629245 CACTGTGAGCACCTGTGCGGAGG - Intronic
1094133581 12:27100668-27100690 CACCTTGGGCACATGTTCTCAGG + Intergenic
1094183732 12:27618715-27618737 CACCTTGGGCACATGTTCTCAGG + Intronic
1094421356 12:30274559-30274581 CAACTTGGGCACATGTTCTCAGG - Intergenic
1094522487 12:31207471-31207493 CACCTTGAGCGCATGTTCTCAGG + Intergenic
1094588644 12:31800840-31800862 CACCTTGGGCACATGTTCTCAGG - Intergenic
1094618449 12:32057393-32057415 CTCCTTGGGCACATGTTCTCAGG + Intergenic
1094618687 12:32059569-32059591 CACCTTGGGCACATGTTCTCAGG + Intergenic
1094644684 12:32311118-32311140 CACCTTGGGCATATGTTCTCAGG - Intronic
1095130242 12:38533420-38533442 CTCTTTGATGAAATGTTCTGGGG + Intergenic
1095215342 12:39540907-39540929 CGCCTTGGGCACATGTTCTCAGG + Intergenic
1095268171 12:40184179-40184201 TACCTTGGGCACATGTTCTCAGG + Intergenic
1095779618 12:46045080-46045102 CACCTTGAGCACATGTCATCAGG + Intergenic
1095896410 12:47284339-47284361 CACTTTGAGCACATGTTCTCAGG + Intergenic
1095999344 12:48115684-48115706 CATCTTGGGCACATGTTCTCAGG + Intronic
1095999554 12:48117776-48117798 CATCTTGAACACATGTTCTCAGG - Intronic
1096034077 12:48448852-48448874 CACCTTGGGCACATGTTCTCAGG - Intergenic
1096353892 12:50923926-50923948 CACCTTGGGCACATGTTCTCAGG - Exonic
1096363344 12:51007226-51007248 CACCTTGGGCACATGTTCTCGGG + Intronic
1097004997 12:55910205-55910227 CACCTAGGGCACATGTTCTCAGG - Intronic
1097255113 12:57667579-57667601 CACTTTGGGCACATGTCGTCAGG + Intergenic
1098200109 12:68045366-68045388 CACTTTGTGCACATGTACCCTGG - Intergenic
1098310115 12:69140156-69140178 CACCTTAGGCACATGTTCTCAGG + Intergenic
1098315787 12:69192086-69192108 CACCTTGGGCACATGTTGTCAGG + Intergenic
1098316109 12:69195000-69195022 CACTTTGGGCATATGTTGTTAGG - Intergenic
1098316164 12:69195531-69195553 CACCTTGGGCACATGTTCTCAGG - Intergenic
1098584544 12:72140499-72140521 CACCTTGGACACATGTTCTCAGG + Intronic
1098638652 12:72814582-72814604 CACCTTGGGCACATGTTCTCAGG - Intergenic
1098674674 12:73273976-73273998 CACCTTAAGCACATGTTCTCAGG - Intergenic
1098831079 12:75363788-75363810 CACCTTGGACACATGTTCTCAGG - Intronic
1098948146 12:76610374-76610396 CACTTTGGGCACATGATCTCAGG + Intergenic
1099200174 12:79667109-79667131 CACCTTGGGCACATGTTGTCAGG + Intronic
1099544168 12:83955712-83955734 CACCTTGGGCACATGTTCTTAGG + Intergenic
1099698006 12:86045112-86045134 CACTATGAGCAGATCTTCAGAGG - Intronic
1099761155 12:86922013-86922035 CACCTTGGGCACATATTCTCAGG - Intergenic
1100072519 12:90737663-90737685 CACCTTGGGCACATGTTCTCAGG - Intergenic
1100261544 12:92936754-92936776 CACCTTGGGCACATGTTCTGAGG + Intergenic
1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG + Intergenic
1100362451 12:93891124-93891146 CACCTTGGGCACATGTTCTCAGG + Intronic
1100619239 12:96255669-96255691 CACCTGGGGCACATGTTCTCAGG - Intronic
1100710632 12:97252467-97252489 CACTTTAGGCACATGTTATCAGG + Intergenic
1100827556 12:98489144-98489166 CACTTTGAGCACACGTTCTCAGG - Intronic
1100855261 12:98752206-98752228 CACCTTGGGCACATGGTCTCAGG + Intronic
1100929709 12:99592764-99592786 CACCTTGGGCACATGTTCTCAGG - Intronic
1100978806 12:100148310-100148332 CACCTTGGGCACATGTTCTCAGG + Intergenic
1101176303 12:102155338-102155360 CACCTTGGGCACATGTTCTCAGG + Intronic
1101517201 12:105447530-105447552 CACCTTGGGCACATGTTCTGAGG + Intergenic
1101679136 12:106947755-106947777 CACTTTGGGCACATGTTCTCAGG - Intergenic
1101823500 12:108202424-108202446 GTCTTTGAGCACCTGTTGTGTGG + Intronic
1102415995 12:112763354-112763376 CACCTTGGGCACATGTTCTCAGG - Intronic
1102428948 12:112866751-112866773 CACTTGGTGCAGACGTTCTGTGG - Exonic
1104204118 12:126620015-126620037 CACCTTGGGCACATGTTCTCAGG - Intergenic
1104298267 12:127538879-127538901 CACCTTGGGCACATGTTTTTGGG + Intergenic
1104339824 12:127937834-127937856 CACCTTGGGCACATATTCTCAGG - Intergenic
1104350475 12:128040848-128040870 CACCTTGGGTACATGTTCTCAGG + Intergenic
1104355414 12:128080782-128080804 CACCTTGGGCACAGGTTCTCAGG + Intergenic
1104449692 12:128859089-128859111 CTCCTTGGGCACATGTTCTCAGG + Intronic
1104671592 12:130684349-130684371 CACCTTGGGCACATGTTCTCAGG + Intronic
1104757110 12:131276217-131276239 CACTTTGGGCACATGTCATCAGG - Intergenic
1105376109 13:19846503-19846525 AACTTGGGGCACATGTTCTCAGG + Intronic
1105580891 13:21694881-21694903 AACTTTTAACACATGTTCAGAGG - Intronic
1105812786 13:24009425-24009447 CACCTAGGGCACATGTTCTCAGG - Intronic
1105967465 13:25397707-25397729 CACCTTGGGCACATGTTCTCAGG - Intronic
1106114734 13:26807461-26807483 CACCTTGGGCACATGTTCTCAGG + Intergenic
1106119824 13:26850950-26850972 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1106123006 13:26877485-26877507 CACTTTGGGCACATGTCATCAGG - Intergenic
1106207823 13:27616035-27616057 CATCTTGGGCACATGTTCTTAGG - Intronic
1106293818 13:28391600-28391622 CACCTTGGGCACATGTTGTCAGG + Intronic
1106397369 13:29394208-29394230 CACCTTGGGCACATGTTCTCAGG - Intronic
1106434433 13:29711320-29711342 CACCTTGGGCACATGTTCTTAGG - Intergenic
1106659928 13:31788527-31788549 CCCTTTGAGGACATTTTATGGGG + Intronic
1106847022 13:33747807-33747829 CACCTTGGGCACATGTTGTCAGG - Intergenic
1106927969 13:34632817-34632839 CACCTTGGGCACATGTTCTCAGG + Intergenic
1107021319 13:35755408-35755430 CACCTTGGGCACATGTTGTCAGG - Intergenic
1107079246 13:36356704-36356726 CACCTTGGGCACATGTTCTCAGG + Intronic
1107155970 13:37167200-37167222 CACCTTGGGCATATGTTCTCAGG + Intergenic
1107174596 13:37385685-37385707 CACCTTGAGCACATGTCATCAGG + Intergenic
1107362928 13:39639385-39639407 CACCTTGGGCACATGTTCTCAGG + Intergenic
1107530797 13:41280460-41280482 CACTTTGGGCACAGGTTCTCAGG + Intergenic
1107911457 13:45109070-45109092 CACTTTGGGCACATGTTGTTAGG + Intergenic
1108047012 13:46392688-46392710 CACCTTGGACACATGTTCTCAGG + Intronic
1108258063 13:48629631-48629653 CACCTTGGGCACATGTTCTCAGG - Intergenic
1108279980 13:48851610-48851632 CACTTTGGACACATGTTCTCAGG + Intergenic
1108315937 13:49237667-49237689 CACCTTGGACACATGTTCTCAGG - Intergenic
1108444855 13:50498068-50498090 CACTGGGAACACATGCTCTGGGG - Intronic
1108463920 13:50695423-50695445 CACCTTGGGCATATGTTCTTAGG - Intronic
1108509791 13:51146500-51146522 CACCTTGGGCACATGTTATCAGG - Intergenic
1108554819 13:51582690-51582712 CACCTTGGGCACATGTTCTCAGG - Intergenic
1108613745 13:52109919-52109941 CACCTTGGGTACATGTTCTTAGG + Intronic
1108821721 13:54358822-54358844 CACCTTGGACACATGTTCTCAGG + Intergenic
1108939327 13:55932634-55932656 CACTTTTAGCAGATGTTTTAAGG - Intergenic
1109102903 13:58209113-58209135 CACCTTGGGCACATGTTCTCAGG - Intergenic
1109177601 13:59175690-59175712 CAACTTGGGCACATGTTCTCAGG - Intergenic
1109471785 13:62816631-62816653 CTCCTTGGGCACATGTTCTCAGG + Intergenic
1109570264 13:64179440-64179462 TACCTTGAGCACATGTTCTCAGG - Intergenic
1109655430 13:65384541-65384563 AACTTTGAGCAAATCTTCAGTGG - Intergenic
1109997472 13:70147778-70147800 CATCTTGGGCACATGTTCTCAGG - Intergenic
1110058847 13:71015420-71015442 TACCTTGGGCACATGTTCTCAGG - Intergenic
1110666395 13:78122475-78122497 CCCCTTGGGCACATGTTGTGAGG - Intergenic
1110718384 13:78733453-78733475 AACCTTGGGCACATGTTCTCAGG + Intergenic
1110784582 13:79509157-79509179 CACCCTGAGCACATGTTGTCAGG - Intronic
1110815949 13:79860130-79860152 CACCTTGGACACATGTTCTTAGG - Intergenic
1110921253 13:81088982-81089004 CACCTTGGGCACATGTTGTCAGG - Intergenic
1110965134 13:81685321-81685343 CACCTTGGGCTCATGTTCTCAGG - Intergenic
1111015289 13:82372243-82372265 CACCTTGGGCACATGTTGTTAGG + Intergenic
1111044714 13:82799444-82799466 CACTTTGGGTACATGTTGTCAGG - Intergenic
1111055681 13:82946809-82946831 TACCTTGGGCACATGTTCTCAGG - Intergenic
1111122495 13:83871896-83871918 CACCTTGGGCACATGTTCTCAGG + Intergenic
1111172120 13:84541257-84541279 CACGTTGGGCACATGTTCTCAGG - Intergenic
1111263330 13:85773221-85773243 CTCTTGGAACACTTGTTCTGTGG + Intergenic
1111280300 13:86014301-86014323 CACCTTGGGCACATGTTGTCAGG - Intergenic
1111480187 13:88814286-88814308 CACCTTGGGCACATGTTGTCAGG - Intergenic
1111563179 13:89979168-89979190 CACCTTGGGAACATGTTCTCAGG + Intergenic
1111731038 13:92077200-92077222 CACCTTGGGCACATGTTCTCAGG + Intronic
1111916416 13:94365175-94365197 CTCTGTGAGCACATATTCTGGGG + Intronic
1112079597 13:95954776-95954798 CACCTCGGGCACATGTTCTCAGG + Intronic
1112261392 13:97881232-97881254 CACCTTTGGCACATGTTCTCAGG + Intergenic
1112280818 13:98061467-98061489 CACCTTGGGCACATGTTCTCAGG + Intergenic
1112605944 13:100905739-100905761 CACCTTGGGTACATGTTCTCAGG + Intergenic
1112689912 13:101880791-101880813 CTATTTGAGCATCTGTTCTGTGG - Intronic
1112868766 13:103942314-103942336 CTCCTTGGGCACATGTTCTCAGG + Intergenic
1112886421 13:104177972-104177994 CACCTTGGGCACATGTTCTCAGG + Intergenic
1113161963 13:107391872-107391894 CACCTTGGGCACATGTTCTCTGG + Intronic
1113740535 13:112709775-112709797 CACCTTGGACACATGTTCTCAGG + Intronic
1113828446 13:113275210-113275232 CACCCTGGGCACATGTTCTCAGG - Intergenic
1113883403 13:113642456-113642478 GACTTTCTGCACATGTTCTTTGG - Intergenic
1114080177 14:19196981-19197003 CACCTTGGGCACATGTTCTCAGG - Intergenic
1114147580 14:19994919-19994941 CACCTTGGGCACATGTTGTTAGG + Intergenic
1114229461 14:20767498-20767520 CACCTTGGGCACATGTCCTCAGG + Intergenic
1114230044 14:20773117-20773139 CACCTTTGGCACATGTTCTCAGG + Intergenic
1114237773 14:20837164-20837186 CACCTTGGGCACATGTTCTCAGG - Intergenic
1114505324 14:23207777-23207799 CACCTTGGGCACATGTTGTCAGG - Intronic
1114520998 14:23335896-23335918 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114521950 14:23345119-23345141 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114742923 14:25116603-25116625 TACCTTGGGCACATGTTCTCAGG + Intergenic
1114752225 14:25217806-25217828 CTCTTGTAGCACATGGTCTGGGG - Intergenic
1114876104 14:26720331-26720353 CATTTTGAGCATCTGTTATGTGG - Intergenic
1114892086 14:26937351-26937373 CACCTTGGCCACATGTTCTCAGG + Intergenic
1114912530 14:27219041-27219063 CACTCTTGGCACAAGTTCTGAGG - Intergenic
1115086464 14:29521332-29521354 CACATTGTACACTTGTTCTGAGG - Intergenic
1115244433 14:31280710-31280732 CACCTTGGGCACATGTTGTCAGG + Intergenic
1115303400 14:31910285-31910307 CACCTTGGGCACATGTTTTCAGG - Intergenic
1115532612 14:34341258-34341280 CACCTTGGGCACATGTTCTTGGG - Intronic
1115901073 14:38148786-38148808 CACCTTAGGCACATGTTCTCAGG + Intergenic
1115914879 14:38301401-38301423 CACTTTGAGCAGATCTTCAGAGG + Intergenic
1115932372 14:38510757-38510779 CACCTTGGGCACATGTTCTCAGG + Intergenic
1116093654 14:40340068-40340090 CACCTTGAGCACATATTCTCAGG - Intergenic
1116310650 14:43322131-43322153 CAACTTGAGCACATGTTCTCAGG - Intergenic
1116351575 14:43870554-43870576 CACCTAGGGCACATGTTCTCAGG - Intergenic
1116471901 14:45295295-45295317 CACTTTGGGCACATGTTCTCAGG + Intergenic
1117209635 14:53482102-53482124 CACATTGGGCACATGTTCTCAGG - Intergenic
1117444100 14:55787358-55787380 CACCTTGGACACATGTTCTCAGG - Intergenic
1117446233 14:55806150-55806172 CACCTTGAGCACATGTCATTAGG - Intergenic
1117861977 14:60101271-60101293 CACCTTGGGCACATGTTCTGAGG + Intronic
1117891800 14:60430197-60430219 CACCTTGGGCACATGTTCTGAGG - Intronic
1117946905 14:61036572-61036594 CACATTCTGCACATGTTCTACGG + Intronic
1117990361 14:61427023-61427045 CACCCTGGGCACATGTTCTCAGG - Intronic
1118105818 14:62658140-62658162 TGCTTTGGGCACATGTTCTCAGG + Intergenic
1118198013 14:63646144-63646166 CACCTTGGGCACATGTCCTCAGG + Intergenic
1118369306 14:65123675-65123697 CATTTTGGGCACATGTTCCCAGG - Intergenic
1118597103 14:67444205-67444227 CACCTTGAGCATATGTTGTCAGG + Intergenic
1119989657 14:79181741-79181763 CACCCTGTGCACATTTTCTGAGG - Intronic
1120033301 14:79667367-79667389 CACTTGGAGAACATGCTCTCGGG + Intronic
1120107556 14:80514253-80514275 CACCTTGGGCACATGTTCTGAGG + Intronic
1120389988 14:83894102-83894124 CACCTTGGGCACATGTCATGAGG + Intergenic
1120466308 14:84862045-84862067 CACCTAGGGCACATGTTCTCAGG + Intergenic
1120618867 14:86738512-86738534 CACCTTGTGCACATGTTCTTGGG - Intergenic
1120690068 14:87582342-87582364 CACCTTGGGCACATGTTCTCAGG + Intergenic
1120694866 14:87633332-87633354 CACCTTGGGCACATGTCCTCAGG - Intergenic
1120769594 14:88364649-88364671 CACCTTGGGCACATGTCCTTAGG - Intergenic
1120771321 14:88383565-88383587 CACTTTGGGCACATGTTCTCAGG - Intergenic
1121163015 14:91762674-91762696 CACCTTGGGCACATGTTCTCAGG - Intronic
1121268482 14:92621399-92621421 CACCTTGGGCACATGTTCTCAGG - Intronic
1121422694 14:93826486-93826508 CATTTTGAGCCCCTGCTCTGTGG - Intergenic
1122062453 14:99145114-99145136 CAACTTGGGCACATGTTCTCAGG + Intergenic
1122342889 14:101039860-101039882 CGAATTCAGCACATGTTCTGAGG - Intergenic
1122360769 14:101161411-101161433 CACCCTGGGCACATGTTCTTAGG - Intergenic
1122653827 14:103243458-103243480 CACCTTGTGCACATGTTCTCAGG + Intergenic
1122709254 14:103643545-103643567 CACCTTGGGCACATGTTCTCAGG - Intronic
1122832621 14:104407920-104407942 CACCTTGGGCACATGTTCTTAGG - Intergenic
1122950264 14:105040588-105040610 CACCTTGGGCACATGTTCTCAGG - Intergenic
1123087840 14:105725848-105725870 CACCTTGCACACATGTTCTCAGG + Intergenic
1123093797 14:105755220-105755242 CACCTTGCACACATGTTCTCAGG + Intergenic
1123159200 14:106261133-106261155 CACTTTGGGCACATGTTATCAGG - Intergenic
1123669743 15:22643841-22643863 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1123876548 15:24629325-24629347 CACCTTGGGCACATGTTCTCAGG + Intergenic
1123883301 15:24696166-24696188 CATTTTGGGCACATGTTGTCAGG - Intergenic
1124064281 15:26325359-26325381 CACCTTGGGCACATGTTCTCAGG + Intergenic
1124208900 15:27746041-27746063 CACCTTGGGCACATGTTCTCAGG + Intergenic
1124230717 15:27943951-27943973 CACCTTGGGTACATGTTCTCAGG + Intronic
1124525716 15:30450257-30450279 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1124658714 15:31528124-31528146 CTCATGGAGCACATGTTGTGGGG + Intronic
1124664291 15:31578927-31578949 CACCTTGGGCACATGTTATTAGG + Intronic
1124772939 15:32557428-32557450 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1124898612 15:33801012-33801034 CACCTTGGGCACATGTTCTCAGG - Intronic
1125022276 15:34997284-34997306 CATCTTGAGCACATGTTCTTAGG - Intergenic
1125341401 15:38679143-38679165 CACCTTGGGCATATGTTCTCAGG + Intergenic
1126118022 15:45226576-45226598 CACCTTGAGCACATGTTCTCAGG - Intergenic
1126158015 15:45583605-45583627 CACCTTGGGCATATGTTCTCAGG - Intergenic
1126508986 15:49444689-49444711 CCCTTTGTGCATATGTTCCGGGG + Intronic
1126644953 15:50866771-50866793 CACCTTGGGCACATGTTCCCAGG - Intergenic
1126662384 15:51045666-51045688 CACCTTGGGCACATGTTCTCAGG + Intergenic
1127021750 15:54756223-54756245 CAGTCTGAGCACATATTCAGAGG + Intergenic
1127229041 15:56968768-56968790 CACCTTGAGCACATGTCATCAGG - Intronic
1127507287 15:59609637-59609659 CACCTTGGGTACATGTTCTCTGG + Intronic
1127648609 15:60983836-60983858 CACCTTGAGCATATGTTCTCAGG + Intronic
1127837199 15:62799453-62799475 CACTTTGAAAAGATGATCTGTGG + Intronic
1127972731 15:63974318-63974340 TACCTTGGGCACATGTTCTGAGG - Intronic
1127981598 15:64039122-64039144 AACTTTGGGCACAGGTCCTGAGG + Intronic
1128469565 15:67940847-67940869 CACCTTGGGCACATGTTCTCAGG + Intergenic
1128849790 15:70942680-70942702 CACCTTGTGCACATGTTCTTGGG - Intronic
1129277007 15:74452362-74452384 CACTTTGTCCACAGGTTCTGGGG + Exonic
1130074502 15:80677004-80677026 CACCTTGGGCACATGTTCTCAGG + Intergenic
1130695163 15:86123768-86123790 CACCTTGAGCACATGTTCTCAGG + Intergenic
1130742229 15:86613080-86613102 CACTTTGGGCACATGTTCTCAGG + Intronic
1130861640 15:87896090-87896112 CACATTGGGCACATGTTCTCAGG + Intronic
1130889736 15:88123596-88123618 CACCTTAGGCACATGTTCTAAGG - Intronic
1131193238 15:90334123-90334145 CACCTTGGGTACATGTTCTCAGG - Intergenic
1131464887 15:92646945-92646967 CACCTTGGGCACATGTTCTCAGG + Intronic
1131636486 15:94238085-94238107 CACCTTGGGCACATGTTCTCAGG + Intronic
1131778385 15:95827205-95827227 CTTTGGGAGCACATGTTCTGGGG + Intergenic
1131871725 15:96770851-96770873 CACCTTGGTCACATGTTCTTAGG + Intergenic
1132263664 15:100447469-100447491 CACCTTGGGCACATGTTCTCAGG + Intronic
1133645912 16:7764369-7764391 CACCTTGGGCACATGTTCTCAGG + Intergenic
1133678488 16:8098268-8098290 TACTATGAGCAAATGCTCTGGGG - Intergenic
1133682063 16:8129070-8129092 CACCTTGGGCACATGTTGTCAGG - Intergenic
1133871367 16:9689467-9689489 TACCTTGAGCACATGTTCTCAGG + Intergenic
1133949592 16:10379879-10379901 CACTTTGGGCACATGTTCTCAGG - Intronic
1134001713 16:10788017-10788039 AACCTTGGGCACATGTTCTCAGG - Intronic
1134001901 16:10789448-10789470 CACCTTGGGCACATGTTCTCAGG - Intronic
1134198868 16:12181267-12181289 CACCTTGGGCACATGTCCTCGGG - Intronic
1134328929 16:13232562-13232584 CACCCTGGGCACATGTTCTCAGG - Intronic
1134368190 16:13598724-13598746 CACCTTGGGCACAGGTTCTCAGG - Intergenic
1134369583 16:13610582-13610604 CACCTTGGGCACATGTTGTCAGG + Intergenic
1134397135 16:13875409-13875431 CACCTTGGGCAGATGTTCTCAGG + Intergenic
1134592595 16:15467758-15467780 CACCTTGAGCATATGTTCTCAGG - Intronic
1134866419 16:17611228-17611250 CACCTTGGGCAGATGTTCTTGGG + Intergenic
1135204765 16:20474133-20474155 CAATTTGGGCACGTGTTCTCAGG + Intronic
1135214128 16:20549680-20549702 CACCTTGGGCACGTGTTCTCAGG - Intronic
1135226158 16:20660038-20660060 CACCTTGGGCACATGTTCTCAGG + Intronic
1135236504 16:20761309-20761331 CACCTTGGGCACATGTTCTCAGG + Intronic
1135776210 16:25258892-25258914 CACCTTGGGCACATGTTCTCAGG - Intergenic
1136480030 16:30535304-30535326 CACCTTGGGCACATGTCGTGAGG - Intronic
1136652524 16:31685083-31685105 CACCTTGAGCACATGTCATCAGG + Intergenic
1137884495 16:52087988-52088010 CACCTTGGGCACATGTTCTCAGG + Intergenic
1138600435 16:58050883-58050905 CACCTTGGGCACATGTTCTCAGG - Intergenic
1138633380 16:58317205-58317227 CACCTTGGACACATGTTCTCAGG + Intronic
1138748188 16:59388311-59388333 CATATTGGGCACATGTTCTCAGG - Intergenic
1138947701 16:61872301-61872323 CACCTTGGGCACATGTTATCAGG - Intronic
1138995406 16:62445679-62445701 CACCTTGGGCACATGTTGTCAGG + Intergenic
1140054297 16:71512031-71512053 CAGCTTGGGCACATGTTCTCAGG - Intronic
1140059913 16:71559682-71559704 CACCTTGGGCACATGTTGTCAGG - Intronic
1140742032 16:77950078-77950100 CACAATGAGCACATGTTCATTGG - Intronic
1140836548 16:78799634-78799656 ACCTTGGAGCTCATGTTCTGTGG + Intronic
1141030620 16:80584591-80584613 CACCTTGGGCACATGTTCTCAGG + Intergenic
1141062398 16:80885463-80885485 TATTGTGAGCACATATTCTGTGG + Intergenic
1141311208 16:82914928-82914950 GACATTGAACACATTTTCTGAGG - Intronic
1141371863 16:83495161-83495183 CACCTTGGGCATATGTTCTCAGG - Intronic
1142442860 16:90112062-90112084 GACCTTGGGCACATGTTCTCAGG - Intergenic
1142464841 17:129329-129351 GACCTTGGGCACATGTTCTCAGG + Intergenic
1142879933 17:2876334-2876356 CACCTTGGGCACTTGTTCTCGGG - Intronic
1143420498 17:6787856-6787878 CACCTTGGGCACATGTTCTCAGG - Intronic
1143444431 17:6999014-6999036 GACTTTGATCAGATCTTCTGGGG + Exonic
1143657588 17:8305248-8305270 TACATTGGGCACATGTTCTCAGG - Intergenic
1143803690 17:9407541-9407563 CACCTTGGGCACATGTTCCCAGG - Intronic
1143887950 17:10079720-10079742 CACCTTGGCCACATGTTCTCAGG + Intronic
1143986391 17:10918228-10918250 CACCTTGGACACATGTTCTTAGG + Intergenic
1144300022 17:13914418-13914440 CGCCTTGGGCACATGTTCTCAGG + Intergenic
1144483095 17:15643586-15643608 CACCTTGGGCACATGTTCTCAGG + Intronic
1144570872 17:16398007-16398029 CACCTTGGGCACATGTTCTCAGG + Intergenic
1144693193 17:17282483-17282505 CACCTTGGGCACATGTCCTGAGG + Intergenic
1144862905 17:18316807-18316829 CACATTGAACACATGTTCAGAGG + Exonic
1144915587 17:18721444-18721466 CACCTTGGGCACATGTTCTCAGG - Intronic
1145024731 17:19459555-19459577 CACTTTGGACACATGTTCTCAGG + Intergenic
1145032301 17:19513648-19513670 CACCTTGGGCACATATTCTCAGG + Intronic
1145223252 17:21106405-21106427 CACCTTGGGCATATGTTCTCAGG - Intergenic
1145243865 17:21255001-21255023 CACCTCCAGCACATGTTCTCAGG - Intergenic
1145287306 17:21515540-21515562 TGCTTTGGGCACATGTTCTCAGG + Intergenic
1145293294 17:21567356-21567378 CATCTTGTGCACATGTTCTCAGG - Intronic
1145386675 17:22418581-22418603 CATCTTGTGCACATGTTCTCAGG + Intergenic
1145390321 17:22450810-22450832 CGCTTTGGTCACATGTTCTCAGG - Intergenic
1145774287 17:27516799-27516821 CACCTTGGGCACATGTTCTCAGG - Intronic
1145887128 17:28390033-28390055 CACCTTGGGCACGTGTTCTCAGG - Intronic
1146238612 17:31192270-31192292 CACTTTGGGCACATGTTCTCAGG - Intronic
1146513133 17:33467864-33467886 CACCTTGGACACATGTTCTCAGG + Intronic
1146602298 17:34228333-34228355 CACCTTGAGCACATGTTCTCAGG + Intergenic
1147920965 17:43916874-43916896 CACCTTGGGCACATGTTCTCAGG + Intergenic
1148166008 17:45484596-45484618 CACCTTGGGCACATGTTCTCAGG + Intronic
1148863032 17:50614433-50614455 AACTTGGGGCACATGTTCTTGGG - Intronic
1148949942 17:51302005-51302027 CACCTTGGGCACATGTTCTCAGG - Intergenic
1149131715 17:53310084-53310106 CACCTTGTGCACATGTACTCTGG + Intergenic
1149136121 17:53366614-53366636 CACCTTGGGTACATGTTCTCAGG + Intergenic
1149170427 17:53803616-53803638 CACTTTGGGCACATGTTCTCAGG - Intergenic
1149217497 17:54374967-54374989 CACCTTGGGCACATGTTCTCAGG - Intergenic
1150397232 17:64831320-64831342 CACCTTGGGGACATGTTCTCAGG + Intergenic
1150909118 17:69369949-69369971 CACCCTGGGCACATGTTCTCAGG - Intergenic
1150956176 17:69862768-69862790 CACCTTGGGCACATGTTCTCAGG + Intergenic
1151044729 17:70905833-70905855 CATTTTGAGCAAAGGTGCTGAGG + Intergenic
1153023818 18:656392-656414 CACCTTGGGGACATGTTCTCAGG + Intronic
1153042997 18:831645-831667 CACCTTGGGCACATGTTCTCAGG + Intergenic
1153121875 18:1738774-1738796 CACTTTGGGCACATGTTCTCAGG - Intergenic
1153136163 18:1920003-1920025 CACCTTGGGCACATGTTCTTAGG - Intergenic
1153138256 18:1942161-1942183 CACCTTGAGCACATATTCTCAGG - Intergenic
1153148068 18:2056286-2056308 CACCTTGGGCACATGTTGTCAGG - Intergenic
1153150942 18:2092289-2092311 CACCTTGGGCACATGTTGTCAGG + Intergenic
1153157173 18:2162816-2162838 CATCTTGGGCACATGTTCTCAGG + Intergenic
1153404800 18:4725218-4725240 CACCTTGAGCACATGTCGTCAGG + Intergenic
1153415907 18:4845355-4845377 CACCTTGGGCGCATGTTCTTAGG + Intergenic
1153432923 18:5038623-5038645 CACCTTGGGCATATGTTCTCAGG - Intergenic
1153526251 18:5997719-5997741 CACCTTGGGCACATGTCCTCAGG + Intronic
1153572672 18:6488719-6488741 CACCTTGAGCACATGTTCTCAGG + Intergenic
1153796700 18:8630159-8630181 CACTTTGGGCACAGGTTGTCAGG - Intronic
1153837492 18:8977079-8977101 CACCTTGGGCACATGTTCTCAGG - Intergenic
1153868151 18:9292094-9292116 CAACTTGGGCACATGTTCTCAGG + Intergenic
1153977963 18:10286169-10286191 CACCTTGGGCACATGTTGTTGGG - Intergenic
1154048494 18:10930542-10930564 CAGTTTGGGCACATGTTCTCAGG + Intronic
1154089212 18:11341989-11342011 CACCTTGGGCACATGTTCTCGGG - Intergenic
1154114467 18:11599110-11599132 CACCTTGGGCACATGTTCTCCGG + Intergenic
1154373972 18:13793592-13793614 CACCTTGGGCACATGTTCTCAGG + Intergenic
1154375509 18:13806096-13806118 CACCTTGGACACATGTTCTCAGG - Intergenic
1154375889 18:13809462-13809484 CACCCTGGGCACATGTTCTCAGG - Intergenic
1155146182 18:23085611-23085633 CACCTTGGGCACATGTTCTCAGG - Intergenic
1155514017 18:26605936-26605958 CACCTTGGGCACATGTTGTCAGG - Intronic
1155736364 18:29227269-29227291 CACTTTGCACACATGTTCTCAGG + Intergenic
1155850601 18:30769433-30769455 CACCTTGAGCACGTGTTGTCAGG + Intergenic
1155954836 18:31948235-31948257 CACCTTGGGCACATGTTCTCAGG - Intronic
1155955357 18:31952302-31952324 CACTTTGGGCACATGCTCTCAGG + Intronic
1156082685 18:33357223-33357245 CACCTTGGGCACATGTTCCTGGG + Intronic
1156185733 18:34660932-34660954 TACTTTGGGCACATGTTCTCAGG + Intronic
1156420474 18:36947328-36947350 CACATTGGGCACAGGTTCTCAGG - Intronic
1156585658 18:38428229-38428251 CATCTTGGGCACATGTTCTCAGG - Intergenic
1156881996 18:42091900-42091922 CACCTTGAGAACATGTTCTCAGG - Intergenic
1156882003 18:42091974-42091996 CACCTTGAGAACATGTTCTCAGG - Intergenic
1157365928 18:47064355-47064377 CAGTTTGTGCACATGTCCTGTGG + Intronic
1157671824 18:49536780-49536802 CACCTTGGTCACATGTTCTCGGG - Intergenic
1157721139 18:49925429-49925451 CACCTTGGACACATGTTCTAAGG + Intronic
1157909739 18:51604507-51604529 CACCATGGGCACATGTTCTCAGG - Intergenic
1157912445 18:51629901-51629923 CACCTTGGGCACATGTTGTCAGG + Intergenic
1158084609 18:53635933-53635955 CACCTTGGGCACATGTTCTCAGG + Intergenic
1158164861 18:54528980-54529002 CACCTTGGGCACATGTTCTCTGG - Intergenic
1158170976 18:54599142-54599164 CACTTTGGACACATGTTCTCAGG + Exonic
1158419129 18:57277443-57277465 CACTTTGAGAAACTGTGCTGAGG - Intergenic
1158617957 18:59005276-59005298 CACTTTAAGAAAATGCTCTGGGG - Intergenic
1158871413 18:61692093-61692115 CACCTTGGACACATGTTCTCAGG - Intergenic
1158894146 18:61897500-61897522 CACCTTGGGCACATGTTCTCGGG - Intergenic
1158972959 18:62685388-62685410 CACCCTGGGCACATGTTCTCAGG + Intergenic
1159323504 18:66886446-66886468 AATTTTGGGCACATTTTCTGAGG - Intergenic
1159324222 18:66894014-66894036 CACCTTGGGCAAATGTTCTGAGG - Intergenic
1159594308 18:70368035-70368057 CACCTTCGGCACATGTTCTCAGG + Intergenic
1159677630 18:71305579-71305601 CACCTTGCACACATGTTCTCAGG - Intergenic
1159786338 18:72718782-72718804 CACCTTGGGCACATGTTCTCAGG + Intergenic
1159918460 18:74205950-74205972 CACCTTGGGCACATGTCCTCAGG + Intergenic
1159937895 18:74383110-74383132 CACCTTGGGCACATGTTCTCAGG - Intergenic
1160537290 18:79601619-79601641 CACCTTAGGCACATGTTCTCAGG + Intergenic
1160591755 18:79948863-79948885 TACTTTGAGTGCATGTTGTGGGG - Intronic
1162294577 19:9804399-9804421 CACTTTTGTCACATGTTCTCAGG - Intergenic
1162482650 19:10937490-10937512 CACCTTGGGTACATGTTCTCAGG - Intergenic
1163745994 19:19047761-19047783 CACCTTGGACACATGTTCTCAGG - Intronic
1164431530 19:28193282-28193304 CACTTTAGGCACATGTCCTTAGG + Intergenic
1164473048 19:28551797-28551819 CATCTTGTGCACATGTTCTCAGG + Intergenic
1165257136 19:34584812-34584834 CACCTTGGGCACATGTCCTCAGG - Intergenic
1165368896 19:35389872-35389894 GACCTTGGGCACATGTTCTCAGG - Intergenic
1165379913 19:35471758-35471780 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1166418318 19:42612396-42612418 CACCTTGGGCACAGGTTCTCAGG + Intronic
1166549878 19:43658159-43658181 CACTTGGATCACTTTTTCTGGGG + Intronic
1166585006 19:43937884-43937906 CACCTTGGGCATATGTTCTCAGG + Intergenic
1166592766 19:44015652-44015674 CACTTTGGGCACATGTTCTCAGG - Intergenic
1166627269 19:44369887-44369909 CACTTTGGGCACATGTTGTCAGG + Intronic
1167943192 19:52963787-52963809 CACCTTGGACACATGTTCTCAGG - Intergenic
1167987507 19:53331269-53331291 CACTTTGGGCACATGTCATCAGG + Intergenic
1168622732 19:57892132-57892154 CACCCTGGGCACATGTTCTCAGG + Intronic
925055268 2:852377-852399 CACCTTGAGCACAGGATCTGAGG - Intergenic
925229471 2:2220190-2220212 CACCTTGGGCACATGTTCTCAGG - Intronic
925357638 2:3253358-3253380 CACCTTGGGCACATGTTCCCAGG + Intronic
925509585 2:4610601-4610623 CACCTTGGGCACAAGTTCTCAGG - Intergenic
925800204 2:7591626-7591648 CACCTTGGGCACATGTTCTCAGG - Intergenic
926412994 2:12624522-12624544 CACTCTGGGCACATGTCCTCAGG - Intergenic
926509290 2:13753352-13753374 CACCTTGCGCACATGTTGTCAGG + Intergenic
926919678 2:17927987-17928009 AACCTTGAGTACATGTTCTCAGG + Intronic
926979979 2:18558970-18558992 CACCTTGGGCACATGTCCTCAGG + Intronic
926999277 2:18775415-18775437 CACCTTGGGCACATGTTCTCAGG + Intergenic
927016671 2:18970512-18970534 TCCTTTAACCACATGTTCTGAGG - Intergenic
927033599 2:19149453-19149475 CACCTTGAGCACATGTCATCAGG - Intergenic
927125557 2:20009976-20009998 CATCTTGAGCACATGTACTCAGG + Intronic
927164279 2:20301153-20301175 CACCTTGGGCACATGTTGTCAGG + Intronic
927452272 2:23219303-23219325 CATTTTGAGAACATTTTCTCTGG - Intergenic
927539767 2:23898556-23898578 CACCTTGGGCACATGTTCTCAGG + Intronic
927589212 2:24338431-24338453 CACCTTGGGCACATGTTCTCAGG + Intronic
927718961 2:25371003-25371025 CACCTTGGGCGCATGTTCTCAGG + Intergenic
927748779 2:25646796-25646818 TACCTTGGGCACATGTTCTCAGG + Intronic
927892825 2:26763137-26763159 CACTTTGGGCACATGTTCTCAGG + Intergenic
928243017 2:29602878-29602900 CACCTTGGGCACATGTTCTCAGG - Intronic
928297066 2:30092771-30092793 CACCTTGAGCACATGCTCTTAGG + Intergenic
928350456 2:30548300-30548322 CACTTTGGGCACATGTTCTCAGG - Intronic
928671633 2:33609046-33609068 CACCTTGGGCACATGTTCTCAGG + Intergenic
928682138 2:33713640-33713662 CACCTTGGGCACATGTCCTCAGG - Intergenic
928716109 2:34062813-34062835 CACCTTGGGCACATGTTCTGAGG - Intergenic
928930162 2:36616125-36616147 CACCATGGGCACATGTTCTCAGG - Intronic
928931525 2:36629826-36629848 CACCTTGGGCACATGTTCTCAGG + Intronic
929211662 2:39364508-39364530 CACTTTGGGCACATGTTCTCAGG - Intronic
929211856 2:39366135-39366157 CACCTTGGGCATATGTTCTCAGG - Intronic
929657588 2:43749434-43749456 CACCTTGGGTACATGTTCTCAGG + Intronic
930150085 2:48050527-48050549 CAACTTGAGCACGTGTTCTCAGG - Intergenic
930467806 2:51776472-51776494 CATTTTGGGCACATGTTCCCAGG - Intergenic
930544351 2:52747526-52747548 CTTTTTGAGAACATGTTCTAGGG + Intergenic
930633883 2:53784296-53784318 CACTTTGGGCACATGCTGTCAGG + Intronic
930678593 2:54231211-54231233 CACCTTGGGCACACGTTCTCAGG + Intronic
930707237 2:54516788-54516810 CACCTTGGGCACATGTTATCAGG - Intronic
931068902 2:58622106-58622128 CACCTTGGGCACATGTTCTCAGG - Intergenic
931285698 2:60829881-60829903 CACTTTGAGAACCTGTGGTGGGG + Intergenic
931317005 2:61142405-61142427 CACCTTGGGCACATGTTCTCAGG - Intergenic
931416744 2:62088810-62088832 GACCTTGGGCACATGTTCTCAGG - Intronic
931418108 2:62100416-62100438 CACCTTGGGCACATGTTCTCAGG - Intronic
931423043 2:62145410-62145432 CATCTTGGGCACATGTTCTCAGG + Intronic
931446340 2:62330370-62330392 CACCTTGGGCGCATGTTCTCAGG - Intergenic
931541425 2:63333763-63333785 CACTTTGGGCACATGTCCTCAGG + Intronic
931561477 2:63566496-63566518 CACTTTGGGCACATGTTGTCAGG + Intronic
931635059 2:64333306-64333328 CACCTTGGGCACATGTTCTCAGG - Intergenic
932172260 2:69567757-69567779 CACCTTGAGCACTTGCCCTGGGG - Intronic
932284499 2:70520835-70520857 AATTTTGAACACATGATCTGGGG - Intronic
932762954 2:74451541-74451563 CACTTTGGGCACATGTTCTCAGG + Intergenic
933035523 2:77392348-77392370 CGCCTTGGGCACATGTTCTCAGG + Intronic
933059145 2:77713834-77713856 CACCTGGGGCACATGTTCTCAGG + Intergenic
933066410 2:77804572-77804594 CACCTTGGGCACATGCTCTCAGG - Intergenic
933066832 2:77808234-77808256 CACCTTGGGCACATGTCCTCAGG + Intergenic
933196820 2:79399979-79400001 CACTTTGGGCACATGTCATGAGG - Intronic
933388982 2:81647638-81647660 CACCTTGGGCACATATTCTCAGG - Intergenic
933432420 2:82199975-82199997 TACCTTGGGCACATGTTCTCAGG + Intergenic
933503209 2:83142927-83142949 GACTTTGAGCACCTGTTCTGAGG - Intergenic
933514504 2:83283638-83283660 CACCTTGGGCACATGTTCTCAGG + Intergenic
933831558 2:86214442-86214464 GCCATTGAGCACCTGTTCTGAGG - Exonic
933939037 2:87230342-87230364 CACCTTGGGCACATGTTCTCAGG - Intergenic
933999652 2:87697183-87697205 CACTTTGGGCCCATGTTCTCAGG + Intergenic
934155737 2:89198351-89198373 CACCTTGGGTACATGTTCTCAGG + Intergenic
934211584 2:89984408-89984430 CACCTTGGGTACATGTTCTCAGG - Intergenic
934537326 2:95145950-95145972 CACCTTGGGCACATGTTCTCAGG + Intronic
934626328 2:95858162-95858184 CACCTTGGGCACATGTTCTCAGG + Intronic
934807233 2:97243154-97243176 CACCTCGGGCACATGTTCTCAGG - Intronic
934830275 2:97514033-97514055 CACTTCGGGCACATGTTCTCAGG + Intronic
934940192 2:98495501-98495523 CACCTTGGGCACATGTTCTCAGG - Intronic
935364558 2:102275659-102275681 CACCTTGGGCACATGTTCTCAGG + Intergenic
935619762 2:105118568-105118590 CATTTTAAGCACAAGTTCAGTGG - Intergenic
935721966 2:105987459-105987481 AACCTTGGGCACATGTTCTCAGG + Intergenic
935722002 2:105987808-105987830 CACCTTGGGCACAAGTTCTCAGG - Intergenic
935808557 2:106772904-106772926 CACCTTGGGCACATGTCCTCAGG - Intergenic
935889589 2:107661984-107662006 CACCTTGGGCACATGTTCTCAGG - Intergenic
936294201 2:111253709-111253731 CACTTTGGGCCCATGTTCTCAGG - Intergenic
936354096 2:111735433-111735455 CACCTTGGGCACATGTTCTCAGG + Intergenic
936633631 2:114231637-114231659 CACCTTGGGCACATGTTATCAGG + Intergenic
936677725 2:114734577-114734599 CACCTTGGACACATGTTCTTAGG + Intronic
936787685 2:116114144-116114166 CACCTTGGGCACATGTTCTCAGG - Intergenic
936796068 2:116205053-116205075 CACTTTGAGCACACCTTTAGCGG - Intergenic
936843819 2:116805504-116805526 TGCTTTGAGCACATGTTCCCAGG + Intergenic
936871166 2:117135375-117135397 CACCTTGGGCACATGTTCTCAGG - Intergenic
936888148 2:117337474-117337496 CACCTTGGCCACATGTTCTCAGG + Intergenic
937522250 2:122725993-122726015 TTCCTTGAGCACATGTTCTCAGG + Intergenic
937551140 2:123094194-123094216 CACCTTGGACACATGTTCTCAGG - Intergenic
937577558 2:123442488-123442510 CACTTTGAACACGTGTTCTCAGG + Intergenic
937644375 2:124249686-124249708 CACCTTGGGCACATGTTCTCAGG + Intronic
937695169 2:124800894-124800916 CACCTTGGGCGCATGTTCTCAGG - Intronic
937696355 2:124812825-124812847 CACCTTGGGCCCATGTTCTCAGG + Intronic
937775358 2:125769511-125769533 CACGTTGGGCACATGTTCTCAGG - Intergenic
938035954 2:128035110-128035132 CACCTTGGGCACATGTTCTCAGG - Intergenic
938060574 2:128251395-128251417 CACCTTGGGCACATGCTCTCAGG - Intronic
938250835 2:129814342-129814364 CACCCTGGGCACATGTTCTCAGG - Intergenic
938546230 2:132334668-132334690 CACTTTGGGCACATGTCGTCAGG - Intergenic
938739898 2:134221172-134221194 CACCTTCGGCACATGTTCTCAGG - Intronic
938875405 2:135527089-135527111 CACCTTGGGCACATGTTCTCAGG + Intronic
939324866 2:140674686-140674708 CACCTTGGGCACGTGTTCTCAGG + Intronic
939496016 2:142929562-142929584 CACCTTGGGCACATGTTCTTAGG - Intronic
940143964 2:150525556-150525578 CACCTTGGGCACATGTTCTCAGG - Intronic
940209890 2:151245499-151245521 CACCTTGGGCACATGTTCTCAGG - Intergenic
940260645 2:151776332-151776354 CACCTTGGGCACATGTTCTCAGG - Intergenic
940360040 2:152787189-152787211 CACATTGAGCACATGTCGTCAGG - Intergenic
940486463 2:154302620-154302642 CATCTTGGGCACATGTTCTCTGG - Intronic
940892417 2:159047742-159047764 CACTTTGGGCACATGTCATCAGG + Intronic
940896942 2:159089884-159089906 CACTTCGAGCACATGCTTTGTGG + Intronic
941227409 2:162866463-162866485 CACCTTGGGCACATGTTTTCAGG - Intergenic
941863556 2:170310283-170310305 CACCTTGAGCACAGATTCTCAGG - Intronic
941908067 2:170736111-170736133 CACATTGGGCACATGTTCTCAGG + Intergenic
941928542 2:170918773-170918795 AACCATGAGCACATGTCCTGAGG - Intergenic
942097800 2:172549738-172549760 CACCTTGGGCACATGTTCTGAGG - Intergenic
942097930 2:172550951-172550973 CACCTTGGGCACATGTTTTCAGG + Intergenic
942174438 2:173318474-173318496 CACTTTGGGCACATGTTCTCAGG - Intergenic
942294022 2:174500147-174500169 CACCTTGGGCACATGTTCTCAGG - Intergenic
942358749 2:175148965-175148987 CACCTTGGGCACATGTTCTCAGG + Intronic
942512416 2:176716723-176716745 CACCCTGAGCACATGTCCTCAGG + Intergenic
942543798 2:177041729-177041751 TACCTTGGGCACATGTTCTCAGG + Intergenic
942936466 2:181562369-181562391 TACTGTGGGCACATGTTCTCAGG + Intronic
943260450 2:185653506-185653528 CACCTTGCGCACATGTCCTCAGG - Intergenic
943483125 2:188446969-188446991 CACCTTGAACAGATGTTCTCAGG - Intronic
943531359 2:189085393-189085415 CTTGTTGAGCACATGATCTGGGG - Intronic
943548328 2:189308884-189308906 CACCTTGGGCACATGTTTTCAGG + Intergenic
943729984 2:191292337-191292359 CATCTTGGGCACATGTTCTCAGG - Intronic
943750120 2:191502149-191502171 CACCTTGGGCACATGTTCTCAGG - Intergenic
943827375 2:192413783-192413805 CATTTGGAGCAGTTGTTCTGGGG + Intergenic
944055688 2:195519854-195519876 CACCTTGGGCACATGTTCTCAGG + Intergenic
944303769 2:198156302-198156324 CACCTTGAGCACATGTCCTTAGG + Intronic
944646167 2:201782741-201782763 CACCCTGGGCACATGTTCTCAGG - Intergenic
944661148 2:201923023-201923045 CACCTTGGGCACATGTTGTCAGG + Intergenic
944720481 2:202418502-202418524 CACCTTGGACACATGTTCTCAGG - Intronic
944968646 2:204966046-204966068 TACTTAGAGCACCTGTTATGAGG + Intronic
945114661 2:206399648-206399670 CACCTTGGGCACATGTTCTCAGG - Intergenic
945742518 2:213680747-213680769 CACCTTGAGCACATGTTCTCAGG - Intronic
945829801 2:214769885-214769907 CATTGTGAGCACATGATCTTTGG - Intronic
946089847 2:217211295-217211317 CACCTTGGGCACGTGTTCTCAGG + Intergenic
946125867 2:217562128-217562150 CACCTTGGGTACATGTTCTCAGG + Intronic
946838360 2:223795380-223795402 CACTTTTTACACATGTTCTTAGG + Intronic
946844485 2:223847336-223847358 CACCTTGGGCACATGTTCTCAGG - Intergenic
946943985 2:224800807-224800829 CACCTTGGGCACATGTTCTCAGG - Intronic
947171798 2:227320072-227320094 CACCTTGGGCACATGTTCTCAGG - Intergenic
947172334 2:227324346-227324368 CACCTTGGACACATGTTCTCAGG + Intergenic
947226071 2:227841545-227841567 CACCTTGAGCTCATGTTCTCAGG - Intergenic
947287953 2:228538632-228538654 CACTTTGGGCACATGTCATCAGG + Intergenic
947618000 2:231570570-231570592 CATCTTGGGCACATGTTCTCAGG - Intergenic
947949762 2:234136955-234136977 CACGTTGGGCACATGTTCTCAGG + Intergenic
947996351 2:234531041-234531063 CATCTTGGGCACATGTTCTCAGG + Intergenic
948016384 2:234694195-234694217 CACCTTGGGCACATGTTCTCAGG + Intergenic
948020071 2:234724755-234724777 CACCTTGGGCACATGTTCTCAGG - Intergenic
948021921 2:234740604-234740626 CACCTTGGGCACATGTTCTCAGG + Intergenic
948321147 2:237070836-237070858 CACTTTGGGCCCATGTTCTCAGG + Intergenic
948445408 2:238029031-238029053 CAATTTGAGCATATGTGCTGCGG + Intronic
948819730 2:240535145-240535167 CACCTTGGGCACATGTTCTGAGG - Intronic
949030089 2:241791118-241791140 CAACTTGGGCACATGTTCTGAGG + Intronic
1168747170 20:253541-253563 CACCTTGGGCACATGTTCTCAGG - Intergenic
1168823089 20:790031-790053 CACCTTGGGCACATGTTCTCAGG - Intergenic
1168843747 20:927593-927615 CACCTTGGGCACATGTTCTCAGG - Intergenic
1168845745 20:943436-943458 CACCTTGGGCACATTTTCTCAGG - Intergenic
1169160776 20:3376548-3376570 CATTTTGGGTACATGTTCTCAGG - Intronic
1169304387 20:4475800-4475822 CACCTTGGGCACATGTTCTCAGG - Intergenic
1169324046 20:4661032-4661054 CACCTTGTGCACATGTGCTCAGG - Intergenic
1169466253 20:5843066-5843088 CATTTTGAGCTCATGTTCAATGG + Intronic
1170074495 20:12404871-12404893 CACTTTGGGCACATGTTCTCAGG - Intergenic
1170544451 20:17423141-17423163 CACCTTGGGCACCTGTTCTCAGG - Intronic
1170564355 20:17588396-17588418 CACCTTGGGCACATGTTCTCAGG + Intronic
1170659436 20:18322613-18322635 CACCTGGGGCACATGTTCTCAGG - Intergenic
1170823862 20:19776916-19776938 CACCTTGGTCACATGTTCTCAGG + Intergenic
1170858244 20:20077567-20077589 CACTTCAGGCACATGTTCTCAGG - Intronic
1170930637 20:20767147-20767169 CACCTTGGGCACATGTCCTCAGG - Intergenic
1171875093 20:30567400-30567422 CACTTTGGGCACATGTCGTCAGG - Intergenic
1172051035 20:32118335-32118357 CACTTTCTGCACATCTTCTGTGG + Intronic
1172566775 20:35936948-35936970 CACCTTGGGCTCATGTTCTCAGG - Intronic
1172772455 20:37389505-37389527 GACCTGGAGCACATGGTCTGTGG - Intronic
1173484900 20:43433804-43433826 CACTTTGAGAATAATTTCTGGGG - Intergenic
1173746417 20:45440809-45440831 CACCTTGGGCACATGTTCTCAGG - Intergenic
1174888635 20:54364393-54364415 CACCTTGAGGACATGTTCTCAGG + Intergenic
1174913939 20:54635689-54635711 CACCTTGGGCAGATGTTCTCAGG + Intronic
1174956212 20:55101685-55101707 TACTTTGGGCACATGTTCTTAGG - Intergenic
1175058362 20:56218780-56218802 CACCTTGGGCACATGTCCTCTGG - Intergenic
1175150187 20:56927863-56927885 CACTTTCAGCCCAGTTTCTGTGG - Intergenic
1175176080 20:57113036-57113058 CACCTTGGGCACATGTTCTCAGG - Intergenic
1175586721 20:60146960-60146982 CACCTGGAGCACATGTTCTCTGG - Intergenic
1175630078 20:60528398-60528420 CACTGTGAGCTGATCTTCTGAGG - Intergenic
1176203667 20:63876633-63876655 GACTTTCTGCCCATGTTCTGTGG - Intronic
1176362230 21:6007354-6007376 TACCTTGGGCACATGTTCTCAGG - Intergenic
1176421837 21:6522433-6522455 CACCTTGGGCACATGTTGTCAGG - Intergenic
1176703725 21:10093073-10093095 CACCTTGGGCACATGTTCTCAGG - Intergenic
1176979743 21:15367405-15367427 CACCTTGGGCACATGTTGTCAGG + Intergenic
1177175957 21:17700944-17700966 TACCTTGGGCACATGTTCTCAGG - Intergenic
1177255876 21:18662300-18662322 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1177271272 21:18851743-18851765 CACCTTGGGCATATGTTCTCAGG - Intergenic
1177396698 21:20545540-20545562 CACTTTAAGCACTTTTTCTCAGG + Intergenic
1177435643 21:21048726-21048748 CACCTGGGGCACATGTTCTCAGG + Intronic
1177662496 21:24104136-24104158 TACTTTGAGCACACGTTCGCAGG - Intergenic
1177814529 21:25961325-25961347 CACTTTGGGCACATGTCATCAGG + Intronic
1178031677 21:28534900-28534922 CACCCTGGGCACATGTTCTTAGG - Intergenic
1178118012 21:29437064-29437086 CACTTTGGGCACATGTCATCAGG - Intronic
1178179674 21:30145301-30145323 CACCCTGGGCACATGTTCTCAGG + Intergenic
1178247438 21:30967594-30967616 CACTTTAGGCACATGTTCTCAGG - Intergenic
1178321398 21:31608674-31608696 CATCTTGGTCACATGTTCTGAGG + Intergenic
1178386886 21:32159616-32159638 CACATTGGGTACATGTTCTCAGG - Intergenic
1178863157 21:36306136-36306158 CACCTTGGGCGCATGTTCTCAGG - Intergenic
1179016084 21:37595434-37595456 TACCTTGGGCACATGTTCTCAGG + Intergenic
1179024641 21:37669328-37669350 CACCTTGGGCACATGTTCTCCGG + Intronic
1179259989 21:39749583-39749605 CACTTTGGGCACATGTTTTCAGG - Intronic
1179373897 21:40831997-40832019 CACTTTGAGCCCAGGTTGTCTGG - Intronic
1179423808 21:41256764-41256786 CACCTTGGGCACATGTTCTCCGG + Intronic
1179619379 21:42602752-42602774 CACCTTGGGCACATGTTCTCAGG - Intergenic
1179622262 21:42624985-42625007 CACCTTGGGAACATGTTCTCAGG + Intergenic
1179697327 21:43130749-43130771 CACCTTGGGCACATGTTGTCAGG - Intergenic
1179731662 21:43371654-43371676 CACCTTGGACACATGTTCTCAGG + Intergenic
1179761288 21:43531191-43531213 TACCTTGGGCACATGTTCTCAGG + Intronic
1179783141 21:43715457-43715479 CACCTTGGGCACATGTTCTCAGG + Intergenic
1179892414 21:44343160-44343182 CACCTTGGACACATGTTCTCAGG - Intergenic
1179915081 21:44471862-44471884 CACCTTGGGTACATGTTCTCAGG + Intergenic
1180106506 21:45622414-45622436 CACATTGTGCACATGTACTCCGG + Intergenic
1180128871 21:45812278-45812300 CACTTTGGGCACATGTTCTCAGG - Intronic
1180178776 21:46107892-46107914 CACCTTGGGTACATGTTCTCAGG + Intronic
1180500596 22:15925703-15925725 CACCTTGGGCACATGTTCTCAGG + Intergenic
1180578507 22:16804869-16804891 CACATTGGGCACATGTACTCAGG + Intronic
1181452389 22:23032406-23032428 CACCTTGGGCACATGTTCTCAGG + Intergenic
1182174483 22:28270086-28270108 CACGTTGGGCACATGTTGTCAGG - Intronic
1182260516 22:29070783-29070805 TATGTTGACCACATGTTCTGTGG - Intergenic
1182401773 22:30083557-30083579 CCCTTTGAGCAGGTGTTTTGTGG - Intronic
1182521337 22:30886125-30886147 CACCTTGGGCACATGTTCTCAGG - Intronic
1183113169 22:35668315-35668337 CACCTGGAGCACATGTTCTCAGG + Exonic
1183636171 22:39064202-39064224 CACCTTGGGCACATGTTATCAGG - Intronic
1183637460 22:39073095-39073117 CACCTTGGGCACATGTTCTCAGG - Intronic
1183643767 22:39110194-39110216 CACTCTGGGCGCATGTTCTCAGG - Intergenic
1183644584 22:39116840-39116862 CACCTTGGGCACATGTTCTCAGG + Intergenic
1183873191 22:40756096-40756118 CACCTTGGGCACATGTTCTTAGG + Intergenic
1184019097 22:41808620-41808642 CACTTAGAGCACAGGGTCAGTGG - Intronic
1184338674 22:43872825-43872847 CACATTGGGCACATGTTCTTAGG + Intergenic
1184579473 22:45404801-45404823 CACCTTGGGCACATGTTCTCAGG + Intronic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
1184917287 22:47578659-47578681 CACCTTGGGCACACGTCCTGAGG + Intergenic
949107776 3:221206-221228 CACCTTGGGCACGTGTTCTCAGG + Intronic
949163909 3:913924-913946 CACCTTGGGCACATGTTGTCAGG + Intergenic
949216988 3:1582691-1582713 CACTTTGAACAGATCTTTTGAGG + Intergenic
949440000 3:4070265-4070287 CACCTTGGGTACATGTTCTCAGG + Intronic
949476593 3:4452580-4452602 TAGTTATAGCACATGTTCTGAGG + Intronic
949530991 3:4954959-4954981 CACCTTGGGCACATGTCCTCTGG - Intergenic
949611816 3:5710598-5710620 CACCTTGAGCACATGTTCTCCGG - Intergenic
949699176 3:6736169-6736191 CACCTTGAGCACATGTCCTCAGG - Intergenic
949811405 3:8010937-8010959 CACCTTGGGCACATGTTCTCTGG - Intergenic
950686352 3:14621331-14621353 CTCTCTGAGCGCAGGTTCTGGGG - Intergenic
950917500 3:16660814-16660836 CACCTTGGGCACATGTTCTCAGG - Intronic
951000623 3:17555293-17555315 CACCTTGGGAACATGTTCTTAGG - Intronic
951332591 3:21384427-21384449 CACCTTGGGCACATGTTCTCAGG - Intergenic
951526121 3:23654777-23654799 CGGTTTGAGCACCTGCTCTGTGG + Intergenic
951644195 3:24868956-24868978 CACCTTGGGCACATGTTCTCAGG + Intergenic
951773308 3:26282543-26282565 CACTTTGAGCACATGTTCTCAGG - Intergenic
951841878 3:27043505-27043527 CACTCTTGGCACAGGTTCTGAGG - Intergenic
952107394 3:30086004-30086026 CACCTTGGGCACATGTTCTCAGG + Intergenic
952202153 3:31141649-31141671 CACCTTGGGCACATGTTGTCAGG + Intergenic
952455015 3:33464701-33464723 CACCTTAGGCACATGTTCTCAGG + Intergenic
953048510 3:39317486-39317508 CACCTTGGGCACATGTTCTCAGG + Intergenic
953147676 3:40293762-40293784 CACTTTGGGCACATGTTCTCAGG + Intergenic
953167064 3:40475034-40475056 CACCTTGAGCACAAGATCTCAGG - Intergenic
953378149 3:42446074-42446096 CACCTTGGGCACAGGTTCTCAGG - Intergenic
953427358 3:42805782-42805804 CACCTTGGGCACATGTTCTCAGG - Intronic
953439435 3:42905599-42905621 CACGTTGGGCACATGTTCTCAGG + Intronic
953505502 3:43482280-43482302 TACCTTGGGCACATGTTCTCAGG + Intronic
953538660 3:43795120-43795142 GACTTTGAGAACATCATCTGAGG - Intergenic
953747804 3:45588335-45588357 CACCTTGGGCACATATTCTCAGG - Intronic
954067045 3:48115148-48115170 CACCTTGGGCACATGTTCTCAGG + Intergenic
954604259 3:51896436-51896458 CACCTTGGGCACATGTTCTCAGG + Intronic
954778756 3:53044846-53044868 CTCCTTGAGCACAAGCTCTGGGG + Intronic
954823375 3:53350159-53350181 CACCTTGGGCACATGTTCTCAGG - Intergenic
955381444 3:58441555-58441577 TACTTTGAACCCATGTTCTCAGG - Intergenic
955416358 3:58695712-58695734 CACCTTGGGCACATGTCCTCAGG - Intergenic
955424821 3:58777360-58777382 CACCTTGGGCACATGTTGTCAGG + Intronic
955489132 3:59464994-59465016 CACTTGGAGCACGTGGGCTGCGG - Intergenic
955516326 3:59729877-59729899 CACCTTGGGCATATGTTCTCAGG + Intergenic
955612977 3:60777226-60777248 CACCTTGGGCACATGTTCTCAGG - Intronic
956372699 3:68581133-68581155 CACTTTGTGCACATGTACCCTGG - Intergenic
956708732 3:72022011-72022033 CACCTTGGGCACATGTTCTCTGG + Intergenic
956716021 3:72080724-72080746 CACCTTGGGCACATGTTCTCAGG - Intergenic
957146568 3:76432634-76432656 CTCTTTGATCACTAGTTCTGAGG - Intronic
957208956 3:77236060-77236082 CACCTTGGACACATGTTCTCAGG - Intronic
957297665 3:78353698-78353720 CACCTTGGGCTCATGTTCTCTGG + Intergenic
957299679 3:78375864-78375886 CACTTTGGGAACATGTTCTCAGG - Intergenic
957305266 3:78449681-78449703 CACCTTGAGTACATATTCTCAGG + Intergenic
957393839 3:79615444-79615466 CACCTTGGGCACATGTTCTGAGG + Intronic
957600233 3:82324368-82324390 CACCTTGGGCACATGTTCTCAGG + Intergenic
957965194 3:87313235-87313257 CACCTTGGGCACATGTTCTCAGG - Intergenic
957983922 3:87548040-87548062 CACCTTAGGCACATGTTCTCAGG - Intergenic
958566449 3:95817283-95817305 CATCTTGAGCACATGTTCTCAGG + Intergenic
959062717 3:101630659-101630681 CACCTTGGGCACATGTTCTCAGG + Intergenic
959241266 3:103797772-103797794 CACCTTGGGCACATGTTCTTGGG - Intergenic
959296831 3:104545933-104545955 CACCTTAGGCACATGTTCTCAGG + Intergenic
959298160 3:104564802-104564824 GTCTTTGTGCACATGTGCTGGGG - Intergenic
959405976 3:105962131-105962153 CACCTTGGGCACATGTTCTCAGG + Intergenic
959440088 3:106363153-106363175 CACTCTGAGCAGATTTTCAGAGG - Intergenic
959584154 3:108010478-108010500 GACTTTGAGCAAATGTTCAGTGG + Intergenic
959690269 3:109190626-109190648 CACCTTGGGCACATGTCCTTAGG + Intergenic
960412739 3:117347859-117347881 CACTCTTATCTCATGTTCTGGGG - Intergenic
960712790 3:120547545-120547567 CACCTTGGGCACATGTCCTCAGG - Intergenic
960723820 3:120650348-120650370 CACCTTGGGCACATGTTCTCAGG + Intronic
961164171 3:124752033-124752055 CACCTTGGGCACATGTTCTTGGG + Intergenic
961394114 3:126574374-126574396 CACCTGGGGCACATGTTCTCAGG + Intronic
961470934 3:127111784-127111806 CACCTTGGGCACATGTTCTCAGG + Intergenic
961790932 3:129376330-129376352 CACCTTGGGCACATGTTCTCAGG - Intergenic
961794333 3:129398778-129398800 CACCTTGGGCACATGTTCTCAGG + Intergenic
961800709 3:129446696-129446718 CACCTTGGGCACATGTTCTCAGG + Intronic
961800750 3:129447217-129447239 CACCGTGGGCACATGTTCTGTGG - Intronic
961896841 3:130175037-130175059 CACCTTAAGCACATGTTGTCAGG + Intergenic
962040954 3:131706993-131707015 CACCTTGGGCTCATGTTCTCAGG + Intronic
962182778 3:133225942-133225964 CATCTTGGGCACATGTTCTAAGG - Intronic
962272420 3:133987626-133987648 CACCTTGGGAACATGTTCTCAGG + Intronic
962467773 3:135676150-135676172 CACCTTGGGCTCATGTTCTCAGG + Intergenic
962749171 3:138420624-138420646 CACATTGGGCACATGTTCTCAGG - Intergenic
963003079 3:140701493-140701515 AACTTTCAGCCCATGGTCTGAGG + Intergenic
963058034 3:141203391-141203413 CACCTTGGGCATATGTTCTCAGG - Intergenic
963167854 3:142223882-142223904 TGCTTTGAGCATTTGTTCTGGGG - Intronic
963169255 3:142234301-142234323 CACTTGGGGCACAGGTTTTGTGG + Intergenic
963433230 3:145235907-145235929 CACATTGGGCAAATGTTCTCAGG + Intergenic
963534895 3:146514857-146514879 CACTGTTAACACATCTTCTGGGG + Intergenic
963669297 3:148231722-148231744 CACCTTGGGCACATGTTCTCAGG - Intergenic
963760310 3:149281569-149281591 CACCTTGGGCACATGTTCTCAGG - Intergenic
964276173 3:155011153-155011175 CACTTTGGGCACATTTTCTCAGG - Intergenic
964276649 3:155015568-155015590 CACCTTGAGCACATGTCGTCAGG + Intergenic
964394568 3:156231917-156231939 AACCTTGGGCACATGTTCTCAGG + Intronic
964458713 3:156897404-156897426 CACCTTGAGCACATGTTCTCAGG - Intronic
964612431 3:158628370-158628392 CACCTTGGGCACATGTTGTTAGG - Intergenic
964612712 3:158631111-158631133 CACCTTGGGAACATGTTCTCAGG - Intergenic
964845620 3:161041367-161041389 CACCTTGGGCACATGTTCGCAGG + Intronic
964860877 3:161199608-161199630 CACCTTGGGCACATGTTGTCAGG + Intronic
964935161 3:162075551-162075573 CACCTTGGACACATGTTCTCAGG + Intergenic
964999533 3:162935582-162935604 CACCTTGGGTACATGTTCTCAGG + Intergenic
965091607 3:164170233-164170255 CACCTTGGGCACATGTTGTCAGG - Intergenic
965180451 3:165395736-165395758 CACCTTGGGAACATGTTCTCAGG + Intergenic
965278861 3:166722860-166722882 CACGTTGAGCACATGTTGTCAGG + Intergenic
965556600 3:170024847-170024869 CACCTTGGGCACATGTTCTCAGG + Intergenic
966073668 3:175909126-175909148 CACATTGTGCACATGTACTGTGG + Intergenic
966537558 3:181051485-181051507 CACTTTGGGCACATGTTCTCAGG - Intergenic
966754376 3:183354747-183354769 GACCTTGGGCACATGTTCTTAGG + Intronic
967105832 3:186254414-186254436 TGCTCTGAACACATGTTCTGAGG - Intronic
967244950 3:187477286-187477308 CACCTTGGGCACATGTTGTCAGG + Intergenic
967521365 3:190436514-190436536 CGCTGTGAGCACATACTCTGTGG + Intronic
967636359 3:191806562-191806584 CACTTTGGGCACATGTTCCCAGG + Intergenic
967748312 3:193084229-193084251 CACTTTGGACACATGTTCTCAGG - Intergenic
967755432 3:193163123-193163145 CACCTTGGGCACATGTTCCCAGG + Intergenic
967886938 3:194339837-194339859 CACCTTGGGCACATGTTCCCAGG - Exonic
968363132 3:198163022-198163044 GACCTTGGGCACATGTTCTCAGG - Intergenic
968383044 4:111366-111388 CACCTTGGGCACATGTTGTCAGG + Intergenic
968501646 4:952968-952990 CACTTTGGGCACAGGGGCTGAGG - Intronic
968561905 4:1288205-1288227 CACCTTGGGCATGTGTTCTGAGG + Intergenic
969079173 4:4605019-4605041 CACCTTGGGCACATGCTCTCGGG + Intergenic
969147486 4:5136862-5136884 GACTTTGAGCACACGGCCTGTGG - Intronic
969346393 4:6573249-6573271 CACCTTGGGCACCTGTTCTCAGG + Intergenic
969653384 4:8481362-8481384 CACCTTGGGCACATGTTCTCAGG + Intronic
969746579 4:9077469-9077491 CACCTTAAGCACATGTTGTCAGG - Intergenic
969918268 4:10511243-10511265 CCCCTTGGGCACATGTTCTCAGG + Intronic
969960990 4:10944732-10944754 CACCTTGGGCACATGTTCTCAGG - Intergenic
970243991 4:14039605-14039627 CATCTTGGGCACATGTTCTCAGG - Intergenic
970276108 4:14403033-14403055 CACCATGGGCACATGTTCTCAGG - Intergenic
970470679 4:16376333-16376355 CACGTTGGGCACATGTTCTCAGG - Intergenic
970740360 4:19230148-19230170 CACCTAGAGCACATGTTCTCAGG + Intergenic
970878790 4:20903704-20903726 CACCTTGGGCACATGTTCTCAGG + Intronic
971006750 4:22382828-22382850 CACCTTGAGCACATGTCATCAGG - Intronic
971333315 4:25700355-25700377 CACCGTGGGCACATGTTCTCAGG + Intergenic
971481945 4:27122864-27122886 CACCTTGGACACATGTTCTCAGG + Intergenic
971713597 4:30148361-30148383 CACCTTGGGCACATGTTCTCAGG + Intergenic
971719380 4:30226067-30226089 CACTTTGGGTACATGTTCTCAGG + Intergenic
971804265 4:31335355-31335377 CACCTTGGGCACATATTCTAAGG - Intergenic
971851566 4:31991712-31991734 CACCTAGTGCACATGTTCTCAGG - Intergenic
971851626 4:31992530-31992552 CAACTTGTGCACATGTTCTCAGG - Intergenic
971975484 4:33680697-33680719 CACGTTGGGCACATGTTCTCAGG + Intergenic
972034508 4:34504558-34504580 CACCTTGGGCACATGTTCTTAGG - Intergenic
972303262 4:37806305-37806327 CACCTTGGGCACATGTTCTCAGG + Intergenic
972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG + Intronic
972814460 4:42628845-42628867 CACTCTGAGCTGATGTTCTCAGG + Intronic
972980965 4:44700597-44700619 CACCTTGGGCACATGTGGTGAGG + Exonic
973096726 4:46211583-46211605 CACTTTGAGAACATGTTTAGTGG + Intergenic
973245946 4:48011610-48011632 CACCTTGGGCACACGTTCTCAGG - Intronic
973336925 4:48966032-48966054 CACCTTGAGCACATGTTCTCAGG + Intergenic
973574213 4:52269708-52269730 CACCTTGGGCACATGGTCTCAGG + Intergenic
974460071 4:62175996-62176018 CAACTTGGGCACATGTTCTCAGG - Intergenic
974594928 4:64002157-64002179 CACTCTGAGCACATGTTCTCAGG - Intergenic
974633825 4:64532769-64532791 CACCTTGGACACATGTTCTCAGG - Intergenic
974868929 4:67614325-67614347 CACCTGGGGCACATGTTCTCTGG + Exonic
974935364 4:68404589-68404611 CACCTTGGGCACATGTTCTCAGG + Intergenic
975051700 4:69873152-69873174 CACCTTGAGCACATGTCATCAGG + Intergenic
975187969 4:71425558-71425580 CACCTTGCGCACATGTTGTCAGG - Intronic
975222361 4:71827735-71827757 CACCTTGGGCACATATTCTTAGG - Intergenic
975224462 4:71855752-71855774 CACCTTAGGCACATGTTCTCAGG - Intergenic
975251010 4:72177451-72177473 CACATTGGGCACATGTTCTTAGG + Intergenic
975425820 4:74226275-74226297 TATTTTGAGCATATGTTCTTTGG + Intronic
975484957 4:74925769-74925791 TACTTTGGGCACATGCTCTCAGG - Intergenic
975614889 4:76236526-76236548 CACCTTGGGCACATGTTCTCAGG - Intronic
975797594 4:78025467-78025489 CACCTTGGGCACATGTTCTCAGG - Intergenic
976011263 4:80492247-80492269 CACCTTGGGCACGTGTTCTCAGG + Intronic
976112039 4:81685911-81685933 CACCTTGGGCACATGTTCTCAGG - Intronic
976127144 4:81845712-81845734 CACCTTGGGTACATGTTCTCAGG + Intronic
976507669 4:85868022-85868044 CACTTTGAGCACATGTTCTTAGG - Intronic
976696106 4:87921284-87921306 CACCTTGGGCACATGTTCTCAGG + Intergenic
976738172 4:88332082-88332104 CACCTTGGGCACGTGTTCTCAGG - Intergenic
977070099 4:92374500-92374522 CACCTTGGGCATATGTTCTCAGG + Intronic
977345513 4:95811712-95811734 CACCTTGGGCACATGTTCTCAGG + Intergenic
977525541 4:98141684-98141706 CACCTTGGGCACATGTTCTCAGG + Intronic
977578414 4:98699168-98699190 CACCTTGGGCACATGTTCTCAGG + Intergenic
977770664 4:100854603-100854625 CATTTTGAGGACATAGTCTGAGG - Intronic
977985235 4:103375274-103375296 CACCTTGGGCACATGTTCTCAGG + Intergenic
978000370 4:103550402-103550424 TACCTTGGGTACATGTTCTGAGG - Intergenic
978016013 4:103747836-103747858 CATTTTGAGCAAATGTTTTGAGG + Intergenic
978162409 4:105564867-105564889 CACCTTGGGCAGATGTTCTCGGG - Intronic
978164321 4:105588431-105588453 CACTTTGATTTCATGGTCTGTGG + Intronic
978337434 4:107684822-107684844 GACCTTGGGCACATGTTCTCAGG + Intronic
978423079 4:108554611-108554633 CACCTTGGGCACATGTTGTCAGG + Intergenic
978575272 4:110183452-110183474 CACCTTGTGCACATGTTCTCAGG + Intronic
978942769 4:114457377-114457399 CACCTTGAGCACAGCTTCTCAGG - Intergenic
978950139 4:114548305-114548327 CACCTTGAGCATATGTTATCAGG - Intergenic
978951288 4:114562218-114562240 CACCTTGGGCACATGTTGTCAGG - Intergenic
979163005 4:117487990-117488012 CATTTTCAGTACATTTTCTGTGG + Intergenic
979239957 4:118439248-118439270 CACCTTGGACACATGTTCTCAGG - Intergenic
979877457 4:125911439-125911461 CACCTTGGGCACATATTCTCAGG - Intergenic
980052783 4:128054870-128054892 CATCTTGGGCACATGTTCTCAGG - Intergenic
980081809 4:128351955-128351977 CACTTTGGGCACATGTTCTCAGG + Intergenic
980279354 4:130699524-130699546 CATCTTGGGCACATGTTCTCAGG - Intergenic
980302647 4:131014204-131014226 CACTCTTAGCAGAGGTTCTGAGG - Intergenic
980329800 4:131395892-131395914 CACCTTGGGCACATGTTCCCAGG + Intergenic
980375943 4:131949426-131949448 CACCTTGGGCACATGTTCTCAGG - Intergenic
980535464 4:134115126-134115148 CTCTTTGAAAACATGTTCTTTGG - Intergenic
980777037 4:137451088-137451110 CACCTTGGGCACATGTTCTCAGG - Intergenic
980983573 4:139674157-139674179 CACCTTGGGCACATGTTGTCAGG - Intronic
981170733 4:141620438-141620460 CACCTTGGGCACATGCTCTCAGG - Intergenic
981189697 4:141847717-141847739 TACCTTGGGCACATGTTCTCAGG + Intergenic
981314412 4:143327937-143327959 CACCTTGGGCACATATTCTCAGG - Intergenic
981523313 4:145687381-145687403 CACCTTGGGCACATGTCCTCAGG + Intronic
981805925 4:148715151-148715173 CACCTTGGGCACATGTTCTCAGG - Intergenic
981903233 4:149890870-149890892 CACCTTGAGCACATGTTCTCAGG - Intergenic
982009372 4:151092120-151092142 CACATTGGGCACAGGTTCTCAGG - Intergenic
982391721 4:154871913-154871935 CACCTTGGGCACATGTTCTCAGG - Intergenic
982398914 4:154944096-154944118 CACCTCGGGCACATGTTCTCAGG + Intergenic
982614295 4:157621639-157621661 CACCTTGGGCACCTGTTCTTGGG - Intergenic
983273774 4:165593080-165593102 CACCTTGGACACATGTTCTCAGG - Intergenic
983631754 4:169856575-169856597 CACCTTGGGCACATGTTGTCAGG - Intergenic
983638218 4:169919576-169919598 CACCTTGGGTACATGTTCTCAGG + Intergenic
983778971 4:171644324-171644346 CACCTTGGGCATATGTTCTGAGG + Intergenic
983822740 4:172216780-172216802 CACCTTGGACACATGTTCTCGGG - Intronic
983863753 4:172738695-172738717 CACCTTGGGCACGTGTTCTCAGG - Intronic
984049106 4:174841846-174841868 CACCTTGCGCACATGTTCTCAGG - Intronic
984086833 4:175323792-175323814 CACCTTGGCCACATGTTCTCAGG + Intergenic
984093233 4:175401887-175401909 CACTTTGGGCACATGTTGTCAGG + Intergenic
984364485 4:178781083-178781105 CACCTTGGGCACATGTTCTCAGG - Intergenic
984393301 4:179166319-179166341 CACCTTGGACACATGTTCTCAGG + Intergenic
985227266 4:187775251-187775273 CACCTTGGGCACATGTTGTCAGG - Intergenic
985377532 4:189356460-189356482 CACTGTGCTCACCTGTTCTGGGG + Intergenic
986646930 5:9925872-9925894 CACCTTGGGCACTTGTTCTCAGG + Intergenic
986689603 5:10303303-10303325 CACCTTGGGCACATGTTCTCAGG + Intronic
986893044 5:12332348-12332370 CACTTTGGGCACGTGTTCTCAGG - Intergenic
986900632 5:12428469-12428491 AACAATGAGCACATGTTTTGGGG + Intergenic
986949508 5:13065752-13065774 CACCTTGAGTACATGTTTTCAGG - Intergenic
987040717 5:14059730-14059752 CACGTTGAGCACACGTTGTCAGG + Intergenic
987265753 5:16253342-16253364 CACTTTGGGCACATGTTCTCAGG - Intergenic
987344038 5:16963196-16963218 CATTTTCAGCACAGGTACTGTGG - Intergenic
987462879 5:18235011-18235033 CACCTTGGGCACATGTTCTCAGG - Intergenic
987486703 5:18534936-18534958 CAACTTGGGCACATGTTCTCAGG + Intergenic
987586194 5:19859808-19859830 CACCTTGGGCACATGTTCTCAGG + Intronic
987680439 5:21129653-21129675 CACCTTGAGCACATGTTCTCAGG - Intergenic
987965202 5:24863857-24863879 CAACTTGGGCACATGTTCTCAGG - Intergenic
988040571 5:25883994-25884016 CACTTTGGTCACATGTTCTCAGG + Intergenic
988183731 5:27833552-27833574 CACTTTGGGCACATGTTCTCAGG - Intergenic
988314085 5:29601499-29601521 CACCTTGGGCACATGTTCTCAGG + Intergenic
988568030 5:32336102-32336124 CACCTTGGGTACATGTTCTCAGG - Intergenic
988633195 5:32952892-32952914 CACCTTGGGCACAAGTTCTCAGG + Intergenic
988637791 5:33005862-33005884 CACCTTGGGCACATGTTCTCAGG + Intergenic
988831427 5:34990886-34990908 CACCTTGGGCACATGTTCTTGGG + Intergenic
988927510 5:36004375-36004397 CACCTTGGGCACATGTTCTCAGG + Intergenic
989319292 5:40116595-40116617 CACCTTGGGCACATGTTCTCAGG - Intergenic
989320953 5:40133060-40133082 CACCGTGAGCACATGTTCTCAGG - Intergenic
989422179 5:41252964-41252986 CACCTTGGGCACATGTTCTAAGG + Intronic
989445725 5:41526200-41526222 CACTTTGGGCACACGCTCTTAGG - Intergenic
989476523 5:41880669-41880691 CTCCTTGGGCACATGTTCTCAGG - Intergenic
989477544 5:41891459-41891481 CACCTTGGGCACATGTTCTCAGG + Intergenic
989541614 5:42625520-42625542 CACCTTGGGCACATGTTCTCAGG - Intronic
989578621 5:43011462-43011484 CACCTGAAGCACATGTTCTCAGG - Intergenic
989830171 5:45907118-45907140 CACTTTAGGCACATGTTCTCAGG - Intergenic
990006992 5:50955176-50955198 CACCTTGGGCACATGTTCTTAGG + Intergenic
990176133 5:53110246-53110268 CACCTTGGGCACATGTCCTCAGG - Intergenic
990186219 5:53212690-53212712 CACCTTGGGCACATGTTCTCAGG - Intergenic
990614165 5:57490159-57490181 CACTTTGGGAACATGTTCTCAGG - Intergenic
990905480 5:60798134-60798156 CACCTTGGGCACATGTTGTCAGG + Intronic
991082866 5:62620142-62620164 CACCTTGGGCACATGTTCTCAGG - Intronic
991175738 5:63685879-63685901 CACCTTGGGCACATGTTGTCCGG + Intergenic
991234634 5:64379367-64379389 CACCTTGAGCACATGTTCTCAGG + Intergenic
991255317 5:64607349-64607371 CACCTTGGGCACATGTTCTCAGG - Intronic
991314229 5:65282194-65282216 CACCTTGGGCATATGTTCTTAGG - Intronic
991424781 5:66479189-66479211 CACCTTGGGCACATGTTCTCAGG + Intergenic
991465241 5:66905622-66905644 CACCTTGGGCACATGTTCTGAGG - Intronic
991615627 5:68494226-68494248 CACCTTGGGCACATGTTGTCAGG + Intergenic
991644834 5:68791410-68791432 CACATTGGGCACATGTTCTCAGG - Intergenic
992115339 5:73533830-73533852 CACCTTGGACACATGTTCTCAGG + Intergenic
992227871 5:74636256-74636278 TACTTTGAGGCCATGTTCAGTGG - Exonic
992453482 5:76894363-76894385 CACCTTGGGCACATGTTCTCAGG + Intronic
992542760 5:77780644-77780666 CACCTTGGGCACATGTTCTCAGG + Intronic
992588864 5:78272318-78272340 CACCTTGGGCACAGGTTCTCAGG + Intronic
992733127 5:79691787-79691809 CACCTTGGCCACATGTTCTCAGG - Intronic
992802163 5:80303480-80303502 CACCTTGGGCACATGTTCCCAGG - Intergenic
992856105 5:80863287-80863309 CACCTTGGGCGCATGTTCTCAGG - Intronic
992930097 5:81634456-81634478 CACCTTGGGAACATGTTCTCAGG + Intronic
993689403 5:90981075-90981097 CACTTTGGGTACATGTTATCAGG - Intronic
993733051 5:91445381-91445403 CACCTTGGGCACATGTTGTCGGG + Intergenic
993965428 5:94354894-94354916 CACCTTGGGCACATGTTCCCAGG - Intronic
993983751 5:94572988-94573010 CACCTTGGGCACATGTTCTCAGG - Intronic
994044806 5:95295820-95295842 CACCTTGAGTACATGTTTTCAGG + Intergenic
994198358 5:96944359-96944381 CATGTTGGGCACATGTTCTCAGG - Intronic
994641266 5:102412283-102412305 CACCTTGAGCACACGTTCTCAGG + Intronic
994685856 5:102950986-102951008 AAAAATGAGCACATGTTCTGGGG - Intronic
994829404 5:104759774-104759796 CACCTTGGGCACATGTTGTTAGG + Intergenic
994859366 5:105168289-105168311 CGCCCTGGGCACATGTTCTGAGG + Intergenic
995101242 5:108308971-108308993 CACTTTCAGAATATGTTCTCAGG + Intronic
995105176 5:108369391-108369413 CACCTTGGGCACATGTTCTCAGG + Intronic
995124075 5:108562675-108562697 CACATTGGACACATGTTCTCAGG + Intergenic
995285722 5:110386081-110386103 CACTTTGGGCACATGTTCTCAGG + Intronic
995311376 5:110716124-110716146 CACCTTGGGCACATATTCTTAGG + Intronic
995454211 5:112334745-112334767 CACCTTGGGCGCATGTTCTCAGG + Intronic
995477391 5:112561988-112562010 CACCTTGGGCACATGTTCTCAGG + Intergenic
995593423 5:113723669-113723691 CACCTTAGGCACATGTTCTTAGG - Intergenic
995596896 5:113756989-113757011 CACTTTGGGCACATATTCTTTGG + Intergenic
995727427 5:115196171-115196193 CACTTTCTTCAGATGTTCTGTGG - Intergenic
995741305 5:115358716-115358738 CACCTTGGGCACATGTTCTCAGG + Intergenic
995823331 5:116263871-116263893 CACCTTGGGCACATGTTCTCAGG + Intronic
995958720 5:117812793-117812815 CTCTTAGAACACATGTTCTTGGG + Intergenic
996236506 5:121137285-121137307 CACCTTGGGCACATATTCTCAGG + Intergenic
996246016 5:121264258-121264280 CACTCTGAGCAGATCTTCAGAGG - Intergenic
996478353 5:123946590-123946612 CACCTTGGGCACATTTTCTCAGG + Intergenic
996628219 5:125596418-125596440 CACCTTGGGCACATGTCCTCAGG + Intergenic
996708272 5:126519002-126519024 CACCTTGGGCACATGTTCTCAGG + Intergenic
996964706 5:129294222-129294244 CACCTTGGGCACATGTTCTCAGG - Intergenic
996995915 5:129696593-129696615 CACCTTCAGCAAATGTTCTCAGG - Intronic
997158841 5:131585999-131586021 CACCTTGAGCACATGTCATGAGG + Intronic
997258102 5:132444611-132444633 CACTTTGGGTACATGTTCTCAGG - Intronic
997756738 5:136406660-136406682 CACCATGGGCACATGTTCTCAGG - Intergenic
998066831 5:139166035-139166057 CACCTTGGGCACATGTTCTCAGG + Intronic
998262017 5:140638930-140638952 CACCTTGGGCACATGTTCTCAGG + Intronic
998729117 5:145053961-145053983 CACTTTGTCCTCATGTTTTGGGG - Intergenic
999088919 5:148918172-148918194 CACTTTGTGCACATGTACCCTGG - Intergenic
999483051 5:151966529-151966551 CACCTTGGGCACATGTTGTTAGG - Intergenic
999870078 5:155740939-155740961 CACTTTGGGCACATGTTCTCAGG - Intergenic
999956667 5:156710495-156710517 CACCTTGGGCACGTGTTCTCAGG - Intronic
1000363783 5:160472445-160472467 CACCTTGGGCCCATGTTCTCAGG - Intergenic
1000574133 5:162954794-162954816 CACTTTGGGCACATGTCGTCAGG - Intergenic
1001076271 5:168630467-168630489 TACTCTGGGCACATGTTCTTAGG - Intergenic
1001274939 5:170343774-170343796 CACCTCGGGCACATGTTCTCAGG - Intergenic
1001867436 5:175117512-175117534 CACTTTGGGACCATGTTCAGAGG - Intergenic
1002371843 5:178761132-178761154 CACTTTGGGCACAGGTTCTCAGG - Intergenic
1002676520 5:180918628-180918650 CACCTTGGGCACATGTTCTCAGG - Intronic
1002703809 5:181147260-181147282 CACCTTGGGCACATGTTGTCAGG + Intergenic
1002740211 5:181429833-181429855 CACCTTGGACACATGTTCTCAGG - Intergenic
1002870018 6:1158176-1158198 CACCTTGGGCACATGTTCTCAGG + Intergenic
1002994570 6:2270711-2270733 CACCTTGGGCACATGTTCTCAGG - Intergenic
1003068025 6:2919839-2919861 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003070451 6:2941483-2941505 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003195163 6:3907876-3907898 CACCTTGGGCACATGTCCTCAGG + Intergenic
1003195839 6:3913802-3913824 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003202399 6:3973931-3973953 CACCTTGGGCACATGTTCTCAGG + Intergenic
1003204153 6:3991821-3991843 CACCCTGGGCACATGTTCTCAGG + Intergenic
1003321407 6:5055283-5055305 CACCTTGGGCACATGTTCTCAGG + Intergenic
1003475493 6:6478333-6478355 TACCTTGGGCACATGTTCTCAGG + Intergenic
1004433522 6:15567716-15567738 CACTTTGGGCACATGTCCTCAGG + Intronic
1004575755 6:16891879-16891901 CACCTTGGGCACATGCTCTCAGG + Intergenic
1004604863 6:17184626-17184648 CACCTTGGGCACATGTTCTCAGG - Intergenic
1005322571 6:24669186-24669208 CACCTTGGGCACATGTTGTCAGG - Intronic
1005331817 6:24758033-24758055 CACCTTGGGCACATGTTCTCAGG - Intergenic
1005363230 6:25052592-25052614 CACCTGGGGCACATGTTCTCAGG - Intergenic
1005371283 6:25136395-25136417 CACCTTGGGCACATGTTGTCAGG + Intergenic
1005449194 6:25956539-25956561 CACCTTGAGCGCTTGTTCTCAGG - Intergenic
1005491850 6:26354465-26354487 CACCTTGGGCACATGTTTTCAGG - Intergenic
1005615615 6:27569485-27569507 TACTTTGAGCACATGTCGTCAGG + Intergenic
1005616194 6:27575438-27575460 CACTTTGAGCACCTGTAAAGAGG - Intergenic
1005621601 6:27625546-27625568 CACTTTGGGCACATGTCATCAGG - Intergenic
1005652841 6:27900341-27900363 CACCTTGGGCACGTGTTCTTAGG + Intergenic
1005684077 6:28235134-28235156 CACCTTGGTCACATGTTCTCAGG - Intergenic
1005784935 6:29235286-29235308 CACCTTGGGCACTTGTTCTCAGG - Intergenic
1005820757 6:29596762-29596784 CACCTTGGGCACATGTTCTCAGG + Intronic
1006042090 6:31264913-31264935 CACATTGAGTACATGTTCTCAGG - Intergenic
1006051636 6:31349777-31349799 CACCTTGAGCACATGTTCTCAGG - Intronic
1006413678 6:33890969-33890991 CACCTTGAACACATGTTCTCAGG + Intergenic
1006993695 6:38238231-38238253 CACCTTGAGCACTTGTTCTCAGG - Intronic
1007012867 6:38434567-38434589 CACCTTGGGCACATGTTGTCAGG + Intronic
1007085398 6:39140934-39140956 CACTTTGTACACAGGCTCTGAGG + Intergenic
1007311458 6:40949540-40949562 CACCTTGGGCACATGTTCTCAGG + Intergenic
1007505567 6:42332651-42332673 CCCTTTGAGCACATTTACAGAGG - Intronic
1007881172 6:45168472-45168494 CACCTTGGGCACATGTTCTCAGG + Intronic
1008226552 6:48925368-48925390 CATCTTGAGCACATGTTCTCAGG + Intergenic
1008464265 6:51813107-51813129 CACCTTGAGCACAAGTTCTCAGG + Intronic
1008650287 6:53554145-53554167 CACCTTGGGCACATGTTCTCAGG + Intronic
1009346472 6:62617788-62617810 CACCTTGGGTACATGTTCTCAGG + Intergenic
1009357127 6:62764714-62764736 CTCCTTGGGCACATGTTCTCGGG - Intergenic
1009511365 6:64553106-64553128 CACCTTGGGCACATGTTCTCAGG + Intronic
1009750798 6:67877248-67877270 CAGCATGAGCACATGTTCTCAGG - Intergenic
1010304430 6:74302258-74302280 CACCTTGGGCGCATGTTCTCAGG + Intergenic
1010383289 6:75248611-75248633 CACCTTGGGCACATGTTCCCAGG + Intronic
1011121284 6:83956236-83956258 CACCTTGGGCACATGTTCTCAGG - Intronic
1011363451 6:86552905-86552927 CACCTTGGGCACATGTTCTCAGG + Intergenic
1011434219 6:87320561-87320583 CACCTTGGGCACATGTTCTCAGG - Intronic
1011510850 6:88099178-88099200 CACCTTGGGCCCATGTTCTCAGG + Intergenic
1011559903 6:88603671-88603693 CACCTCGGGCACATGTTCTCAGG + Intergenic
1011685048 6:89817206-89817228 CACCTTGGGCACATTTTCTCAGG + Intronic
1011750677 6:90451766-90451788 CACCTTGGGTACATGTTCTCAGG + Intergenic
1012227276 6:96718497-96718519 CACCTTGGGCACATGTTCTCAGG + Intergenic
1012249158 6:96960679-96960701 CACCTTGGGCACATGTTCTCAGG - Intronic
1012573870 6:100765658-100765680 CACATTGAGCACATGTCATCAGG + Intronic
1012650153 6:101742487-101742509 CACCTTGAGGACGTGTTCTCAGG - Intronic
1013010068 6:106112338-106112360 CACTTTGAGCAAATGAACTTGGG - Intergenic
1013211256 6:107988941-107988963 CACCTTGGGCACATGTTCTCAGG + Intergenic
1013412673 6:109895784-109895806 CATCTTGGGCACATGTTCTCAGG - Intergenic
1013419135 6:109950355-109950377 CACCTTGGGCACATGTTGTCAGG - Intergenic
1013888124 6:114996108-114996130 CACCTTGGGCACATGTTTTCAGG - Intergenic
1014159918 6:118156329-118156351 CACCTTGGGCACATGTTCTCAGG - Intronic
1014242781 6:119035913-119035935 CACCTTGGGCATATGTTCTCAGG + Intronic
1014252536 6:119129239-119129261 CACTTTGAGCACATGTTCTCAGG + Intronic
1014315967 6:119864959-119864981 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014442953 6:121494351-121494373 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014488069 6:122025621-122025643 CTCTTTGAGGACAGGATCTGAGG - Intergenic
1014816328 6:125939614-125939636 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014887438 6:126798797-126798819 CACCTTGGGCACATGTTGTCAGG - Intergenic
1014931148 6:127337602-127337624 CACCTTGGGCACATGTTCTCAGG + Intronic
1015327575 6:131940974-131940996 CACCTTGGGCACAAGTTCTCAGG - Intergenic
1015681589 6:135814584-135814606 CACCTTGGGCACATATTCTCAGG - Intergenic
1015704043 6:136068153-136068175 CACCTTGGGCACATGTTCTCAGG - Intronic
1015824292 6:137295343-137295365 TACCTTGGGCACATGTTCTCAGG + Intergenic
1016028619 6:139314564-139314586 CACCTTGACCACACGTTCTCAGG + Intergenic
1016293855 6:142552857-142552879 CACGTTAGGCACATGTTCTCAGG + Intergenic
1016295065 6:142565105-142565127 CACCTTGGCCACATGTTCTCAGG - Intergenic
1016374018 6:143402204-143402226 CACCTTGAACACATGTTCTCAGG - Intergenic
1016513339 6:144867606-144867628 TACCTTGAGCACATGTTTTCAGG - Intergenic
1016521556 6:144952207-144952229 CACTTGGGGCACATGTTCTCAGG + Intergenic
1016557866 6:145359957-145359979 CACCTTGGGCACATGTTCTCAGG - Intergenic
1016602466 6:145877987-145878009 CACCTTGGGCACATGTTCTCAGG + Intronic
1016699244 6:147035044-147035066 TACCTTGGGCACATGTTCTCAGG - Intergenic
1016854264 6:148650768-148650790 CATCTTGGGCACATGTTCTCAGG - Intergenic
1016871088 6:148817428-148817450 CACCTTGGGCACGTGTTCTCAGG - Intronic
1016964951 6:149710203-149710225 CACCTTGGGCACATGTTCTCAGG + Intronic
1017349085 6:153418727-153418749 CACCTTGAGCACATGTTCTCAGG - Intergenic
1017778530 6:157698423-157698445 CACCTTGGGCACATGTTCTCAGG - Intergenic
1017863395 6:158420979-158421001 CACTTTGGGCACATGTTCTCAGG - Intronic
1018076121 6:160215121-160215143 CACCTTGGGCACATGTTCTCAGG + Intronic
1018190033 6:161302533-161302555 CACCTTGCACACATGTTCTCAGG + Intergenic
1018255971 6:161919721-161919743 CACTGTGAGCATTTGCTCTGTGG - Intronic
1018363681 6:163097550-163097572 CACCTTAGGCACATGTTCTCAGG - Intronic
1018454119 6:163937062-163937084 CACCTTGGGCACATGTTCTCAGG + Intergenic
1018486949 6:164250238-164250260 AACCTTGGGCACATGTTCTAAGG + Intergenic
1018561297 6:165103284-165103306 CACCTTGGGCACATGTTCTCGGG - Intergenic
1018780256 6:167057381-167057403 CACCCTGGGCACATGTTCTCAGG - Intergenic
1018807479 6:167272515-167272537 CACCTTGGGCACATGTTCTCAGG - Intronic
1018808848 6:167282733-167282755 CACCTTGGGCACATGTTCTCAGG - Intronic
1018992042 6:168681613-168681635 CACTTTGGACACATGTTCTCAGG + Intergenic
1019030335 6:169004645-169004667 CACCTTGGGCACATGTTCTCAGG + Intergenic
1019030475 6:169006134-169006156 CACCTTGGGGACATGTTCTCAGG - Intergenic
1019063008 6:169270527-169270549 CACCTTGGGCACATGTTCTCAGG + Intergenic
1019099703 6:169619470-169619492 CACTTTGGGCACATGTTCTGAGG - Intronic
1019106912 6:169675510-169675532 CACCTTGGGTACATGTTCTCAGG - Intronic
1019107358 6:169679229-169679251 CACCTTGGGCACACGTTCTCAGG + Intronic
1019151472 6:170008852-170008874 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1019156794 6:170044700-170044722 TACTGTGAGCACAGGCTCTGTGG - Intergenic
1019234462 6:170598105-170598127 CACCTTGGGCACATGTTGTCAGG - Intergenic
1019245324 6:170705433-170705455 CACCTTGGACACATGTTCTCAGG - Intergenic
1019252549 7:25690-25712 GACCTTGGGCACATGTTCTCAGG + Intergenic
1019296262 7:276917-276939 CACCTTGGGTACATGTTCTCAGG + Intergenic
1020046499 7:5044882-5044904 CACTTTGGGCTCACGTTCTCAGG + Intronic
1020291861 7:6728799-6728821 CACTTTGGGCTCACGTTCTCAGG + Intergenic
1020340953 7:7110535-7110557 CACCTTGAGCACATGTTGTCAGG + Intergenic
1020794759 7:12665975-12665997 CACCTTGGGCACATGTTCTCAGG - Intergenic
1020808479 7:12821285-12821307 CACCTTGGGCACATGTTCTCAGG + Intergenic
1020851257 7:13356205-13356227 CACCTTGGGCACATGTTCTCAGG + Intergenic
1020851691 7:13361593-13361615 CACTTTGAGCACATATCGTCAGG + Intergenic
1020870603 7:13624577-13624599 CACTTTTACCACAACTTCTGTGG + Intergenic
1020985373 7:15127172-15127194 CACCTCGGGCACATGTTCTCAGG + Intergenic
1021099857 7:16575171-16575193 CACCTTGGGCACATGTTCTCAGG + Intronic
1021147481 7:17106761-17106783 CACCTTGGGCACATGTTGTCGGG + Intergenic
1021387669 7:20051565-20051587 CACCTTGGGCACATGTTCTCAGG + Intergenic
1021738684 7:23663769-23663791 CATCTTGGGCACATGTTCTCAGG + Intergenic
1021788057 7:24172436-24172458 CACTTTGGGCACATGTTCTCAGG + Intergenic
1021802127 7:24317422-24317444 CACCTTGGGCACATGTTATCAGG + Intergenic
1021978291 7:26030282-26030304 CACTTTGGGCACATGTTCTCAGG - Intergenic
1022004592 7:26255756-26255778 CACGTTGGGAACATGTTCTCAGG - Intergenic
1022616551 7:31936864-31936886 CACCTTGTGCACATATTCTCAGG - Intronic
1022764929 7:33401432-33401454 CACCTTAGGCACATGTTCTTAGG - Intronic
1022985406 7:35649513-35649535 CACCTTGGGCACATGTTCTCAGG - Intronic
1023308588 7:38857766-38857788 CACCTTGGGCACATGTTCTGAGG - Intronic
1023391918 7:39719008-39719030 CACCTTGGGCACATGTTCTCAGG - Intergenic
1023410054 7:39881312-39881334 CACCTTGGGCACATGTTGTCAGG + Intergenic
1023411681 7:39894426-39894448 CACTTTGGGCACATGTTCTCAGG + Intergenic
1023667543 7:42540569-42540591 CACCTTGGGCACATGTTCTCAGG - Intergenic
1024122131 7:46254140-46254162 CACCTTGGGCACATATTCTCAGG + Intergenic
1024160677 7:46671875-46671897 CACCTTGAGTACATGTTCTCAGG + Intergenic
1024305573 7:47926477-47926499 CACCTTGGGCACAAGTTCTTAGG + Intronic
1024329836 7:48144755-48144777 CACCCTGGGCACATGTTCTCAGG + Intergenic
1024329969 7:48145863-48145885 CACCTTGGGCATATGTTCTCAGG + Intergenic
1024600583 7:50976990-50977012 CACCTTGGGCACATGTTGTCAGG - Intergenic
1024716438 7:52085100-52085122 CACCTTGGGCACATGTTCTTAGG - Intergenic
1024719201 7:52115964-52115986 CACCTTGAGCACATGTCATCAGG + Intergenic
1024722146 7:52149226-52149248 AACCTTGGGCACATGTTCTCAGG + Intergenic
1024927448 7:54632393-54632415 CACCTTGGGCACATGTTGTCAGG + Intergenic
1024928741 7:54646839-54646861 CACTTTGGACACATGTTCTCAGG - Intergenic
1025005365 7:55350070-55350092 CACCTTGGGCACATGTTCTCAGG + Intergenic
1025039077 7:55624020-55624042 CACCTTGGGCACATGTTGTCAGG - Intergenic
1025067327 7:55868521-55868543 CACTTTGGGCACATGTCATCGGG - Intergenic
1026143159 7:67723384-67723406 CACCTTGGGCACATGTTCTCAGG + Intergenic
1026210070 7:68296217-68296239 CACCCTGGGCACATGTTCTGAGG - Intergenic
1026308714 7:69165957-69165979 CACCTTGAGCCCATGTTCTCAGG - Intergenic
1026496617 7:70909123-70909145 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1026538054 7:71256629-71256651 CACCTTGCGCACGTGTTCTCAGG + Intronic
1026562259 7:71460100-71460122 CACCTTGGGCACATGTTCTTAGG + Intronic
1026606484 7:71820392-71820414 CACCTTGGGCACATGTTCTCAGG + Intronic
1026614001 7:71885530-71885552 CACCGTGGGCACATGTTCTCAGG + Intronic
1026727062 7:72878362-72878384 CACTTTGGGCTCACGTTCTGAGG + Intergenic
1027275036 7:76548339-76548361 CACTTTGGGCTCACGTTCTCAGG + Intergenic
1027517868 7:79164819-79164841 CATCTTGGGCACATGTTCTCAGG + Intronic
1027601554 7:80246601-80246623 CACCTTTGGCACATGTTCTTAGG - Intergenic
1027869805 7:83693134-83693156 CACCTTGAGCACATGTTTTTAGG - Intergenic
1027979367 7:85197589-85197611 CACCTTGGGCAGATGTTCTGAGG + Intergenic
1028281718 7:88937976-88937998 CACCTTGGGCACATGTTCCCAGG - Intronic
1028347393 7:89799076-89799098 CATTCTGAGCACATATTCAGAGG - Intergenic
1028788606 7:94826553-94826575 CACCTTGGGTACATGTTCTCAGG + Intergenic
1028914398 7:96242866-96242888 CACCTTGGGCACATGTTCTCAGG + Intronic
1029499785 7:100921715-100921737 CACCTTGGGCACCTGTTCTTAGG - Intergenic
1030118118 7:106079180-106079202 CACCTTGGGCACATGTTCTCAGG + Intergenic
1030396284 7:108990694-108990716 CACATTGGGCACATATTCTCAGG - Intergenic
1030495130 7:110289153-110289175 CACCTTGGGCACATGTTCTCAGG + Intergenic
1030558171 7:111052637-111052659 CACCTTGGGCATATGTTCTCAGG + Intronic
1030877363 7:114831662-114831684 CACCTTGGGCACATGTTCCCAGG + Intergenic
1031534599 7:122917474-122917496 CACCTTGGGCACATGTTCTCAGG + Intergenic
1031620236 7:123926571-123926593 CACCTTGGACACATGTTCTCAGG - Intronic
1032420352 7:131774387-131774409 CACTTTGGGCACATGTTCTCAGG + Intergenic
1032612138 7:133426005-133426027 CACCTTGGGCACGTGTTCTCAGG + Intronic
1032801332 7:135319400-135319422 CACCTTGGGCACATGTCCTCAGG + Intergenic
1032885140 7:136129371-136129393 TACTTTGGGCACATGTTGTCAGG + Intergenic
1033122482 7:138678296-138678318 CACCTTGGGCACACGTTCTCAGG + Intronic
1033162402 7:139009281-139009303 CACCTTGGGCACATGTTCCCAGG + Intergenic
1033162955 7:139013318-139013340 CACCTTGGGCACATGTTCTGAGG + Intergenic
1033175760 7:139122281-139122303 CACCTTGGGCTCATGTTCTCAGG - Intergenic
1033610402 7:142959075-142959097 CACCTTGGGCACATGTTCTCAGG + Intronic
1033626956 7:143119723-143119745 CACTTTGGGCACATGTTCTCAGG - Intergenic
1033627080 7:143120903-143120925 CACCTTGGGCACATGTTGTCAGG - Intergenic
1033627787 7:143127898-143127920 CTCCTTGGGCACATGTTCTCAGG + Intergenic
1033635383 7:143207245-143207267 CACTTTGGGCATATGTTCTCAGG - Intergenic
1033942804 7:146677037-146677059 CACCTTGGGCACATGTTCTCAGG - Intronic
1034060061 7:148079176-148079198 CACCTTGGGCACATGTTTTCAGG - Intronic
1034110044 7:148527956-148527978 CACCTTGGGCATATGTTCTCGGG + Intergenic
1034443952 7:151102166-151102188 CACCCTCAGCACATGCTCTGAGG - Intronic
1034730171 7:153380464-153380486 TACTTTCAATACATGTTCTGGGG + Intergenic
1035209304 7:157316050-157316072 CACCTCGGGCACATGTTCTCAGG + Intergenic
1035359817 7:158303944-158303966 CACCTTGGGCACATGATCTTAGG - Intronic
1035449548 7:158967576-158967598 CACCTTGGGCACATGTTCTCAGG - Intergenic
1035502803 8:102769-102791 CACCTTGGACACATGTTCTCAGG + Intergenic
1035687043 8:1531914-1531936 CACCTTGGGCACATGTCCTCAGG - Intronic
1035810979 8:2490962-2490984 CACCTTGGGCACATGTTCTCAGG - Intergenic
1035826249 8:2647034-2647056 CACCCTGGGCACATGTTCTCAGG + Intergenic
1035835132 8:2741898-2741920 CATCTTGGGCACATGTTCTCAGG + Intergenic
1035989590 8:4474520-4474542 AACTTTGAGCAGATGTCATGGGG + Intronic
1036057979 8:5281024-5281046 CACCTTGGGCACATGTTCTCAGG + Intergenic
1036216002 8:6880317-6880339 CACCTGGAGCACATGTTGTTAGG + Intergenic
1036219868 8:6912374-6912396 CACTTCTGGCACATGTTCTAAGG + Intergenic
1036289227 8:7472736-7472758 CACCTTGGGCACATGTCCTCAGG - Intronic
1036295239 8:7529402-7529424 TACCTTGGGCACATGTTCTGAGG - Intergenic
1036327331 8:7791616-7791638 TACCTTGGGCACATGTTCTGAGG + Intergenic
1036332254 8:7838791-7838813 CACCTTGGGCACATGTCCTCAGG + Intronic
1036390812 8:8322919-8322941 CACTTTGGGAACATGGTCTCAGG + Intronic
1036494706 8:9259670-9259692 CACTTTTGGCACACGTTCTCAGG + Intergenic
1036525343 8:9529534-9529556 CACCTTGGGCACATGTTCTCAGG + Intergenic
1036636718 8:10555835-10555857 CACCTTGGGCACATGTTCTCAGG + Intergenic
1036801101 8:11793433-11793455 CACTTTTAGCAAATTTTCTAGGG - Intergenic
1037142663 8:15537427-15537449 CACCTCGGGCACATGTTCTCAGG + Intronic
1037413079 8:18618344-18618366 CACCTTGGGCACATGTTCTCAGG + Intronic
1037543754 8:19897777-19897799 CACCTTAGGCACATGTTCTCAGG + Intergenic
1037653143 8:20858796-20858818 CACTTTGAGTACTTCTTCTCTGG - Intergenic
1037959505 8:23085189-23085211 CACCTTGGGCACATGTTGTCAGG - Intronic
1038279890 8:26154364-26154386 AACCTTGGGCACATGTTCTTGGG + Intergenic
1038458310 8:27693298-27693320 AACATTGGGCACATGTTCTTAGG + Intergenic
1038506555 8:28089836-28089858 CACCTTGGACACATGTTCTCAGG - Intronic
1038739120 8:30201181-30201203 CACCTTGGGCACATGTTCTCAGG + Intergenic
1038739462 8:30204188-30204210 CACCTTGGGCACATGTTCTTAGG - Intergenic
1038988543 8:32840583-32840605 CACCTTGGGCACATGTTCTCAGG - Intergenic
1039220002 8:35320079-35320101 CACCTTGGGCACATGTTCTCAGG - Intronic
1039354346 8:36798847-36798869 CACCTTGGGCACATGTTCTCAGG + Intronic
1039757422 8:40538455-40538477 CACCTTAAGCACATGTTCTCAGG + Intronic
1039761684 8:40583657-40583679 CACTTTGGGCACATGTCCTCAGG - Intronic
1039813662 8:41072862-41072884 CACCTTGGGCACATGTTCTCAGG - Intergenic
1040055621 8:43055107-43055129 CACCCTGGGCACATGTTCTCAGG - Intronic
1040402065 8:47061260-47061282 CACCTTGGGCATATGTTCTCAGG + Intergenic
1040523324 8:48196468-48196490 CACCTTAAGCACATGTCCTCAGG + Intergenic
1040664644 8:49618459-49618481 CACCTTGGGCACATGTTCTCAGG + Intergenic
1040714061 8:50225576-50225598 CACCTTGGGCACATGTTCACAGG + Intronic
1040838890 8:51762733-51762755 CACCTTGGGCACATGTTCTCAGG + Intronic
1040853140 8:51922894-51922916 CACCTTGGGCACATGTTCTCAGG - Intergenic
1040921891 8:52629936-52629958 CACCTTGGGCACATGTTCTCAGG + Intronic
1040945131 8:52876363-52876385 CACTTCAGGCACATGTTCTTAGG - Intergenic
1040962766 8:53052204-53052226 CACTCTGAGCAGATCTTCAGAGG - Intergenic
1040997932 8:53420539-53420561 CACCTTGGGCACATGTTCTCAGG + Intergenic
1041177506 8:55211870-55211892 CACCTTGGGCACATGTTCTCAGG - Intronic
1041317692 8:56581642-56581664 GACCTTGGGCACATGTTCTCAGG + Intergenic
1041330128 8:56715295-56715317 CACATTGAGGACATATGCTGTGG + Intergenic
1041364441 8:57086548-57086570 CATTTTGGGCACATGTTGTCAGG - Intergenic
1041609372 8:59826705-59826727 CACCTTGGGCACATGTTCTCAGG + Intergenic
1041650781 8:60300244-60300266 CACCTTGGGCACATGTTGTGAGG - Intergenic
1041741980 8:61165734-61165756 CACCTTGGGCACATGTTCTCAGG + Intronic
1041767515 8:61434467-61434489 CACCTTGGGCACATGTTCTTAGG - Intronic
1041805386 8:61843729-61843751 CACCTTGGGCACATGTTCTCAGG + Intergenic
1042184504 8:66123333-66123355 CACCTTGGGCACCTGTTCTCGGG + Intergenic
1042520051 8:69701758-69701780 CACCTTGGGCACATGTTCTCAGG + Intronic
1042818937 8:72909249-72909271 ATCTTAGAGCACATGTCCTGTGG - Intronic
1043002868 8:74780760-74780782 CACCTTGGGCACACGTTCTCAGG + Intronic
1043222933 8:77689283-77689305 CACCTTGGGCACATGTTCTCAGG + Intergenic
1043233018 8:77826076-77826098 CACCTTGAGCATATGATCTCGGG + Intergenic
1043348718 8:79332555-79332577 CACATTCAGAACTTGTTCTGAGG - Intergenic
1043535336 8:81196949-81196971 CACCTTGGGCACATGTTCTCAGG + Intergenic
1043676853 8:82967616-82967638 CACCTTGGGCACATGTTGTAAGG - Intergenic
1043740784 8:83808780-83808802 CACCTTGGGCACATGTTCTCAGG + Intergenic
1043924476 8:86021395-86021417 CACCTTGGGCACATATTCTCAGG - Intronic
1043925310 8:86030290-86030312 CACCTTGGGCACACGTTCTTAGG + Intronic
1043948613 8:86282535-86282557 CACATTGGACACATGTTCTCAGG - Intronic
1044012593 8:87012913-87012935 CACCCTGGGCACATGTTCTCAGG + Intronic
1044019248 8:87083967-87083989 CACCTTGGGCACATGTTCTCAGG + Intronic
1044083133 8:87909407-87909429 CTGTTTGGGCACATGTTCTCAGG + Intergenic
1044169759 8:89034793-89034815 TATTTTGAACAGATGTTCTGTGG - Intergenic
1044188258 8:89282274-89282296 GACCTTGGGCACATGTTCTTAGG + Intergenic
1044593802 8:93939600-93939622 CACCATGGGCACATGTTCTCAGG - Intergenic
1044996156 8:97839981-97840003 CTTTTTCAGCCCATGTTCTGTGG + Intronic
1045114356 8:98966903-98966925 AGCTTTGATCACATGCTCTGAGG + Intergenic
1045556987 8:103224285-103224307 CACCTTGGGCACATGTTCTCGGG - Intronic
1045579473 8:103462983-103463005 CACCTTGGGCACATGTTCTCAGG - Intergenic
1045877701 8:107001421-107001443 CATCTTGGGCACATGTTCTCAGG - Intergenic
1046006344 8:108490726-108490748 CACCTTAGGCACATGTTCTCAGG - Intergenic
1047135135 8:122069476-122069498 CACCTTGGGTACATGTTCTCAGG - Intergenic
1047522457 8:125605585-125605607 CATCTTGGGCACATGTTCTCAGG - Intergenic
1048383287 8:133887755-133887777 TAGTTTGAGAACATGTTCTGAGG - Intergenic
1048655989 8:136536389-136536411 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1048671424 8:136727420-136727442 CACCTTGGGTACATGTTCTCAGG - Intergenic
1048777935 8:137968089-137968111 CACCTTGCGCACATGTTCTCAGG + Intergenic
1048800635 8:138190991-138191013 CACCTTGGGCACGTGTTCTCAGG + Intronic
1049007660 8:139865877-139865899 CACCTCGGGCACATGTTCTCAGG - Intronic
1049200958 8:141340306-141340328 CACCTTGAACACATGGTCTGAGG - Intergenic
1049250338 8:141585184-141585206 CACCTTGGGCACATGTTATCAGG + Intergenic
1049454367 8:142679506-142679528 CACCTTGGGCACATGTTCTCAGG - Intronic
1049461851 8:142733763-142733785 CACCTTGGGCACATGTTGTCAGG - Intronic
1049467660 8:142759509-142759531 CACCTTGGGCACATGTTCTCAGG + Intergenic
1049544442 8:143223102-143223124 CACCTTGAGCATATGCTCTCAGG - Intergenic
1049959975 9:728986-729008 CACCTTGGGCACATGTTGTCAGG + Intronic
1049964392 9:765335-765357 CACTTTGGGCACATGTTTTCAGG + Intergenic
1050060748 9:1707177-1707199 CATCTTGGGCACATGTTCTCAGG + Intergenic
1050299915 9:4247484-4247506 AAATTTGCGCATATGTTCTGGGG + Intronic
1050330210 9:4538173-4538195 CACCTTGGGCACATGTCCTCAGG - Intronic
1050495767 9:6240201-6240223 CACTTTGAGCACATGTTCTCAGG - Intronic
1050698740 9:8311774-8311796 CATTTTGAGGCCATGTTATGAGG + Intergenic
1050797407 9:9561367-9561389 CAGTGTGGGCACATGTTCTCAGG + Intronic
1050922865 9:11228337-11228359 CACCTTGGGCACATGTTGTTAGG - Intergenic
1050944173 9:11497696-11497718 CACCTTGGGCACATGTTCTGAGG - Intergenic
1050952512 9:11616013-11616035 CACCTTGGGCACAGGTTCTTAGG - Intergenic
1051050560 9:12927559-12927581 CACGTTGGGCACATGTTCTCAGG + Intergenic
1051065701 9:13099671-13099693 CACCTTGGGCACATGTTCTCAGG + Intergenic
1051097064 9:13477917-13477939 CACTGTGAGCAGATCTTCAGAGG - Intergenic
1051270994 9:15354692-15354714 CACCTTGGGCCCATGTTCTCAGG - Intergenic
1051271203 9:15356531-15356553 CACCTTGGACACATGTTCTCAGG + Intergenic
1051506502 9:17832620-17832642 CACCTTGGGCACATATTCTCAGG + Intergenic
1051626682 9:19105503-19105525 CATCTTGGGCACATGTTCTCAGG - Intergenic
1051770077 9:20567982-20568004 GACTTGGAGTCCATGTTCTGTGG + Intronic
1052121973 9:24729364-24729386 CACCTTGGGCACACGTTCTCAGG + Intergenic
1052176981 9:25473940-25473962 CACCTTGGGCACATGTTCTCAGG + Intergenic
1052180493 9:25520143-25520165 CACCTTGGGCACCTGTTCTCAGG + Intergenic
1052206982 9:25854419-25854441 CACCTTGGGCACATGTTTTCAGG + Intergenic
1052450311 9:28621413-28621435 CACTTGGAGAAAAAGTTCTGTGG - Intronic
1052472431 9:28916703-28916725 CACCTTGGGAACATGTTCTCAGG + Intergenic
1052715150 9:32106949-32106971 CTCTTTGAGAACATTTTCTGAGG + Intergenic
1053083297 9:35195443-35195465 AACCTTGGGCACATGTTCTCAGG + Intronic
1053485536 9:38452300-38452322 CACCTTGAGAACATTTTTTGAGG - Intergenic
1053582879 9:39425269-39425291 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1053594308 9:39544400-39544422 CACCTTGGACACATGTTCTCGGG + Intergenic
1053640992 9:40080093-40080115 CACCTTGGGCACATGTTCTCAGG - Intergenic
1053765144 9:41385375-41385397 CACCTTGGGCACATGTTCTCAGG + Intergenic
1053847065 9:42250133-42250155 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1053852089 9:42299444-42299466 CACCTTGGACACATGTTCTCGGG + Intergenic
1054104458 9:60984012-60984034 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1054321736 9:63676389-63676411 CACCTTGGGCACATGTTCTCAGG - Intergenic
1054543760 9:66296537-66296559 CACCTTGGGCACATGTTCTCAGG + Intergenic
1054571945 9:66820558-66820580 CACCTTGGACACATGTTCTCGGG - Intergenic
1054581885 9:66922838-66922860 CACCTTGGGCAAATGTTCTCAGG - Intronic
1054711008 9:68510714-68510736 CACCTTGGGCACATGTTCTCAGG - Intronic
1054858021 9:69922100-69922122 CACCTTGGGCACATGTTCTCAGG + Intergenic
1055013853 9:71595048-71595070 CCACTTGAGCACATGTTCTCAGG + Intergenic
1055108584 9:72537621-72537643 TACCTTGGGCACATGTTCTCAGG - Intronic
1055328309 9:75155568-75155590 CACCCTGGGCACATGTTCTCAGG - Intergenic
1055449480 9:76418006-76418028 CACCTTGGGCACATGTTCTCAGG - Intergenic
1055649590 9:78394283-78394305 CACCTTGAGTACATGTCCTCAGG + Intergenic
1055776796 9:79775133-79775155 CACCTTGGGCACATGTTCTCTGG - Intergenic
1055968961 9:81892642-81892664 CACTTTGAGAAATTCTTCTGTGG + Intergenic
1056208774 9:84344919-84344941 CACCTTGGGCAAATGTTCTTAGG + Intergenic
1056422081 9:86438396-86438418 CACCTTGGGCACATGTTGTCAGG + Intergenic
1056681940 9:88727006-88727028 CACCTTGGGCACATGCTCTCAGG - Intergenic
1056715708 9:89026575-89026597 CACCCTGGGCACATGTTCTCAGG + Intronic
1056868455 9:90253522-90253544 CACCTTGGGCCCATGTTCTCAGG + Intergenic
1056876059 9:90331784-90331806 CACCTTGGGCACATGTTCTCAGG + Intergenic
1056884590 9:90428847-90428869 CACTCTGAGCCCATGTTCCGCGG + Intergenic
1056891749 9:90500868-90500890 CACCTTGAACACATGCTCTCAGG - Intergenic
1056902052 9:90608966-90608988 CACCTTGGGCACATGTTCTCAGG - Intergenic
1056921230 9:90790985-90791007 CACCTTGGGCACATGTTCTCAGG - Intergenic
1056995426 9:91452826-91452848 CACCTTGGGCACATGTTGTCAGG + Intergenic
1057010897 9:91600472-91600494 GACTTTGAGCACTTGAACTGGGG - Intronic
1057348777 9:94276993-94277015 CACCTTGGGTACATGTTCTCAGG - Intronic
1057888641 9:98851179-98851201 CACCTTGGGCACATATTCTCAGG + Intergenic
1057909540 9:99006961-99006983 CACCTTGGGCACATGTTGTCAGG - Intronic
1057910239 9:99014709-99014731 CACCTTGGGCACATGTTGTCAGG - Intronic
1057931420 9:99196772-99196794 CACCTTGGGCACATGTTGTCAGG + Intergenic
1057943991 9:99308781-99308803 CACCTTGGGCACATGTTCTCAGG + Intergenic
1058125460 9:101189109-101189131 CACTTTGAGCACATGTTCTGAGG - Intronic
1058370020 9:104255548-104255570 CACCTTGGGCACATGTTATCAGG + Intergenic
1058638905 9:107064151-107064173 CACCTTGGGCACATGTTCTTAGG + Intergenic
1059214544 9:112548437-112548459 CACCTTGGGTACATGTTCTTAGG + Intronic
1059523683 9:114968492-114968514 CACCTTGGGCACATATTCTCAGG + Intergenic
1059546681 9:115183036-115183058 CATTTTGGGCACATGTTCTCAGG - Intronic
1059546813 9:115184016-115184038 CACCTTGGGCACATGTTGTCAGG + Intronic
1059568967 9:115413967-115413989 CACCTTGGGGACATGTTCTCAGG - Intergenic
1059872043 9:118588250-118588272 GACCTTGGGCACATGTTCTTAGG - Intergenic
1059883777 9:118721484-118721506 AATTTTGAGCGCATGTACTGGGG + Intergenic
1060057361 9:120426289-120426311 CACTTTGGGCACATGTTCTCAGG - Intronic
1060163212 9:121386313-121386335 CACCTTGGGCACATGTTCTTAGG - Intergenic
1060794896 9:126506809-126506831 CACTCTGAGCACATGTCCGGGGG + Exonic
1061031247 9:128084683-128084705 CACCTTGGGCTCATGTTCTCAGG + Intronic
1061736989 9:132668534-132668556 CACCTTGGGCACATGTTCTCAGG - Intronic
1061742694 9:132718685-132718707 CACCTGGAGCACATGTTCTCAGG + Intergenic
1061824645 9:133250471-133250493 CACCCTGGGCACATGTTCTCAGG - Intronic
1062258477 9:135643735-135643757 CACCTTGGGGACATGTTCTCAGG - Intergenic
1062258838 9:135647245-135647267 CGCCTTGGGCACATGTTCTCAGG + Intergenic
1062492208 9:136811168-136811190 CACCTTGGGCACATGTCCTCAGG - Intronic
1062551411 9:137089007-137089029 TACTTTGAGCAAATGGTGTGGGG + Intronic
1062747819 9:138226682-138226704 GACCTTGGGCACATGTTCTCAGG - Intergenic
1202788762 9_KI270719v1_random:63168-63190 CACCTTGGGCACATGTTCTCAGG - Intergenic
1203435418 Un_GL000195v1:132617-132639 CACTGTAAACACATCTTCTGGGG - Intergenic
1203583117 Un_KI270746v1:33166-33188 CACCTTGGGAACATGTTCTCAGG - Intergenic
1203605520 Un_KI270748v1:54641-54663 CACCTTGGACACATGTTCTCAGG - Intergenic
1185738908 X:2514631-2514653 CACTTTGGGGACATGTTGTCAGG - Intergenic
1185760876 X:2689581-2689603 CACCTTGAGGACACGTTCTCGGG + Intergenic
1185788758 X:2912472-2912494 CACCTTGAGTACATGTTCTCAGG + Intronic
1185795646 X:2962193-2962215 CACCTTGGGCACACGTTCTTGGG + Intronic
1185803969 X:3040098-3040120 CACCTTGGGCACTTGTTCTCAGG + Intergenic
1185805006 X:3049117-3049139 CACATTGGGCGCATGTTCTCAGG - Intronic
1185805286 X:3051299-3051321 AACCCTGAGCACATGTTCTCAGG + Intronic
1185811445 X:3114186-3114208 CACCTTGGGCACATGTTGTCAGG - Intergenic
1185849524 X:3472602-3472624 CACCTTGGGCACATGTTCTCAGG - Intergenic
1185852220 X:3499816-3499838 CACTTTGTGCACATGTTGTCAGG - Intergenic
1185894403 X:3844514-3844536 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185899521 X:3882938-3882960 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185904637 X:3921367-3921389 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185908960 X:3965002-3965024 CGCCTTGGGCACATGTTCTCAGG + Intergenic
1185934594 X:4241411-4241433 CACCTTGGGCACATGTTGTCAGG + Intergenic
1185975989 X:4720538-4720560 CACATTGGGCACATATTCTCAGG + Intergenic
1185983384 X:4804262-4804284 CATTTTGGGCACATGTTCTCAGG - Intergenic
1186011918 X:5143759-5143781 CACCTTGGGCCCATGTTCTCAGG + Intergenic
1186012932 X:5157040-5157062 CACCTTGGACACATGTTCTCAGG + Intergenic
1186029287 X:5349335-5349357 CACCTTGGGCACATGTTGTGAGG - Intergenic
1186156222 X:6729437-6729459 CACCTTGGGCACATGTTGTCAGG + Intergenic
1186328477 X:8506731-8506753 CACCTTGGGCACATGTTCTCAGG - Intergenic
1186329764 X:8519475-8519497 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1186340858 X:8644964-8644986 TACCTTGGGCACATGTTCTCAGG + Intronic
1186440268 X:9580087-9580109 CACCTTGGGCACATGTACTCAGG - Intronic
1186691168 X:11977580-11977602 CACCTTGGGCACATGTTCTCAGG - Intergenic
1186783312 X:12935206-12935228 CACCTTGGGCACATGTTGTCAGG - Intergenic
1186811989 X:13199320-13199342 TACCTTGGGCACATGTTCTCAGG + Intergenic
1187057303 X:15753115-15753137 CACCATGAGCACATGTTCTCAGG + Intronic
1187125039 X:16446888-16446910 CACCTTGGGCACATGTTCTCAGG + Intergenic
1187161462 X:16769031-16769053 CACGTTGGGCACATGTTGTCAGG - Intergenic
1187324655 X:18275162-18275184 CACCTTGGGCACATGTTCTCAGG + Intronic
1187388169 X:18867244-18867266 CACCTTGGGCACATGTTCTCAGG + Intergenic
1187616149 X:20995527-20995549 CACTTTGGGCACATGTCGTCAGG + Intergenic
1187663579 X:21577588-21577610 AAATTTGAGGACATTTTCTGAGG - Intronic
1188074162 X:25754871-25754893 CGATTTGGGCACATGTTCTCAGG + Intergenic
1188285989 X:28326163-28326185 CACCTTGGGTACATGTTCTCAGG - Intergenic
1188390320 X:29611532-29611554 CACCTTGGGCACATGTTCTCAGG + Intronic
1188439656 X:30202821-30202843 CACCTTGGACACATGTTCTCAGG + Intergenic
1188455268 X:30357085-30357107 CACATTGAGGATATGTTTTGAGG + Intergenic
1188803835 X:34562974-34562996 CACCTGGGGCACATGTTCTCAGG - Intergenic
1188839052 X:34992462-34992484 CACCTTGGGCACATGTCCTTAGG - Intergenic
1188876068 X:35431605-35431627 CACCTTGGGCACATGTTCTCAGG - Intergenic
1188876780 X:35440433-35440455 CACTTTGAACACATGTTCTTAGG + Intergenic
1188898143 X:35695278-35695300 CACCTAGGGCACATGTTCTCAGG + Intergenic
1188902710 X:35753709-35753731 CATCTTGGGCACATGTTCTCAGG - Intergenic
1188911457 X:35852948-35852970 CACCTTGGGCATATGTTCTCAGG + Intergenic
1188939561 X:36219874-36219896 CACCTTGAGCACATGTTGTCAGG + Intergenic
1189443626 X:41060220-41060242 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1189443952 X:41063393-41063415 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1190360393 X:49643831-49643853 CACCGTGGGCACATGTTCTCAGG + Intergenic
1190408278 X:50109575-50109597 CACCTTGAGCACATGTTGTCAGG + Intergenic
1190408752 X:50113935-50113957 CACCTTGGGCACATGTTCTCTGG - Intergenic
1190498270 X:51048877-51048899 CACCTTGGGCACATGTTCTCAGG - Intergenic
1190569822 X:51769802-51769824 CACCTTGAGCACATGTTCTTAGG + Intergenic
1190570645 X:51778278-51778300 CACCTTGGGCTCATGTTCTTAGG + Intergenic
1190810771 X:53881302-53881324 CACCTTGGGCGCATGTTCTCAGG + Intergenic
1190867054 X:54393607-54393629 CACCTTGGGCACACGTTCTCAGG + Intergenic
1190951820 X:55153159-55153181 CACCTTGAGCACATGTTGTCAGG + Intronic
1191021549 X:55866268-55866290 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191088888 X:56598809-56598831 CATTGTGGGCACATGTTCTCAGG + Intergenic
1191127705 X:56975189-56975211 CGCCTTGGGCACATGTTCTCAGG - Intergenic
1191189140 X:57647894-57647916 CACCTTGGGCACATATTCTCAGG - Intergenic
1191200852 X:57779744-57779766 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191624458 X:63255377-63255399 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191830877 X:65414967-65414989 CATGTTGGGCACATGTTCTTAGG - Intronic
1192087547 X:68115856-68115878 CACCTTGGGCACAAGTTCTCAGG - Intronic
1192132496 X:68565662-68565684 CACCCTAAGCACATGTTCTCAGG + Intergenic
1192283257 X:69706499-69706521 CACCTTGGGCACATATTCTCAGG - Intronic
1192675805 X:73194879-73194901 CACCTTGTGTACATGTTCTTAGG - Intergenic
1192703933 X:73508694-73508716 CACATTGGGCACATGTTCTCAGG - Intergenic
1192728932 X:73782812-73782834 CACCTTGGGCACATGTTCTCAGG - Intergenic
1192732071 X:73810428-73810450 TACTTTGGGTACATGTTCTCAGG + Intergenic
1193001323 X:76565659-76565681 CACTTTGTGCACATGTACCCTGG + Intergenic
1193180977 X:78456295-78456317 CACCTTGGGCACATGTTGTCAGG - Intergenic
1193302656 X:79908958-79908980 CACCATGGGCACATGTTCTCAGG + Intergenic
1193531765 X:82663240-82663262 CACCTTGGGCACATGTTGTCTGG - Intergenic
1193532377 X:82671363-82671385 CACCTTGGGCACATATTCTCAGG - Intergenic
1193553276 X:82925043-82925065 CACTCTGAGCATATCTTCAGAGG - Intergenic
1193809605 X:86036172-86036194 CACCTTGGGCACATGTTCTCAGG - Intronic
1193972130 X:88067641-88067663 CACCTTTGGCACATGTTCTCAGG - Intergenic
1194003723 X:88464511-88464533 CACTTTGCGCACATGTCATCAGG + Intergenic
1194010789 X:88558611-88558633 CACTTTGAGCACATGTTCTCAGG + Intergenic
1194075009 X:89380412-89380434 CACCTTGGGCACATGTTCTCAGG - Intergenic
1194089319 X:89565660-89565682 CCCCTTGGGCACATGTTCTCAGG - Intergenic
1194104583 X:89753140-89753162 CGCTTTGGGCACATATTCTCAGG - Intergenic
1194138877 X:90182555-90182577 CACCTTGGGCACATGTTCTCAGG + Intergenic
1194204882 X:91001340-91001362 CACCTTGGGCACATGTTCTCAGG + Intergenic
1194289215 X:92048806-92048828 CACCTTGGGCACATGTTCTCAGG - Intronic
1194292436 X:92091517-92091539 CACCTTGGGCACATGTTCTCAGG - Intronic
1194294163 X:92107778-92107800 CACCTTGGGCACATGTTCTCAGG + Intronic
1194351961 X:92831706-92831728 CACCTTGGGTACATGTTCTCAGG + Intergenic
1194456893 X:94115922-94115944 CACCTTGGGCACATGTTCTCAGG - Intergenic
1194480110 X:94411488-94411510 CATCTTGGGCACATGTTCTCAGG + Intergenic
1194485910 X:94485988-94486010 CACCTTGGGCAAATGTTCTTAGG - Intergenic
1194534063 X:95084505-95084527 CACCTTGGGCACATGTCCTCAGG - Intergenic
1194620496 X:96164900-96164922 CACCTTGGACACATGTTCTCAGG + Intergenic
1195146276 X:102020154-102020176 CACCTTGGACACATGTTCTCAGG + Intergenic
1195151127 X:102071563-102071585 CACTCTGAGAAAATATTCTGAGG + Intergenic
1195256504 X:103096169-103096191 CTCCTTGGGCACATGTTCTCAGG + Intergenic
1195258779 X:103113434-103113456 CACCTTGGGCATATGTTCTTAGG + Intergenic
1195463405 X:105153563-105153585 CACCTTGGACACATGTTCTCAGG - Intronic
1195493097 X:105496275-105496297 CACCTTGGGCACATGTTCTCAGG + Intronic
1195515159 X:105765811-105765833 CACATTCAGCACATATTGTGGGG - Intronic
1195546384 X:106116838-106116860 CACCTTGGGCACATGTTTTCAGG - Intergenic
1195546917 X:106123326-106123348 CACCTTGGACACATGTTGTGAGG - Intergenic
1195547006 X:106123989-106124011 CACTTTGGGCACACGTTCTCAGG - Intergenic
1195557856 X:106247907-106247929 CACCTTGGGTACATGTTCTCAGG - Intergenic
1195566540 X:106345707-106345729 TACCTTGGGCACATGTTCTCAGG - Intergenic
1195647846 X:107252840-107252862 CACCTTGCGCACATGTTGTCAGG + Intergenic
1195759161 X:108227416-108227438 CACCTTGGCCACATGTTCTCAGG - Intronic
1196072547 X:111542670-111542692 CACCTTGGACACATGTTCTCAGG - Intergenic
1196287343 X:113897968-113897990 CACCTTGGGCACATGTTCTCAGG - Intergenic
1196301950 X:114058101-114058123 CACCTTGGGCACTTGTTCTCAGG + Intergenic
1196409849 X:115406857-115406879 CATTGTGAGCTCATGTTCTTTGG + Intergenic
1196543661 X:116937827-116937849 CACAAGGAACACATGTTCTGAGG + Intergenic
1196566731 X:117215275-117215297 CATCTTGAGCACATGTTGTCAGG - Intergenic
1196763042 X:119217398-119217420 CACCTTGGGCACATGTTCTCAGG - Intergenic
1196884292 X:120228262-120228284 CACTTTGACCACATGTTGTCAGG + Intergenic
1196884968 X:120235680-120235702 CACCTTGGGCACATGTCGTGAGG + Intergenic
1196992078 X:121341087-121341109 CAGTTTGAGCAAAACTTCTGAGG - Intergenic
1197026003 X:121750221-121750243 CACCTTGGGCATATGTTCTGAGG + Intergenic
1197296076 X:124720547-124720569 CACCTTGGGCACATGTTGTCAGG + Intronic
1197352514 X:125395471-125395493 CACCTTGGGCACATGTTCTCAGG - Intergenic
1197468127 X:126832188-126832210 CACCTTGGGAACATGTTCTTAGG - Intergenic
1197665030 X:129214193-129214215 CACTTGGATCACCTGCTCTGAGG + Intergenic
1197930682 X:131691589-131691611 CACCTTGGACACATGTTCTCAGG - Intergenic
1197930942 X:131695695-131695717 CACCTTGAGCACATGTTCTCAGG - Intergenic
1198258510 X:134945995-134946017 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1198306474 X:135388693-135388715 CACCTTGGGCACATGTTGTCAGG + Intergenic
1198579534 X:138048650-138048672 CACACTGAGCAGATCTTCTGAGG + Intergenic
1198644601 X:138792442-138792464 CACTTTGGTCACATGCTCTAGGG - Intronic
1198837914 X:140823855-140823877 CACTCTGAGCAGATCTTCAGAGG - Intergenic
1198880092 X:141271786-141271808 CACTTTGGGCACATGTCCTCAGG - Intergenic
1198982897 X:142419412-142419434 TACCTTGGGCACATGTTCTCAGG + Intergenic
1199171495 X:144739392-144739414 CACCTGGAGCACGTGTTCTCAGG + Intergenic
1199184912 X:144904892-144904914 CACCTTGGGCACATGTTCTCAGG + Intergenic
1199186414 X:144920713-144920735 CACCTTGGGCACATGTTGTCAGG - Intergenic
1199260481 X:145767745-145767767 CTCTTTGGGCACATGTTCTCAGG + Intergenic
1199336799 X:146628001-146628023 CACCTTGGGCAAATGTTCTCAGG + Intergenic
1199355563 X:146859499-146859521 CACCTTGGGCACATGTTGTCAGG - Intergenic
1199357834 X:146882124-146882146 CACCTTGGACACATGTTCTCTGG - Intergenic
1199367446 X:147003432-147003454 CACCTTGGGCACATGTTCTCAGG + Intergenic
1199368690 X:147019966-147019988 TACCTTGGGCACATGTTCTCAGG - Intergenic
1200056082 X:153461999-153462021 CACCTTGTGCACATGTTCTCAGG + Intronic
1200293399 X:154893266-154893288 CACCTTGAGCACATGTTCTCAGG + Intronic
1200293502 X:154894211-154894233 CATCTTGGGCACATGTTCTCAGG + Intronic
1200389087 X:155925511-155925533 CACCTTGGGCACATGTTGTCAGG - Intronic
1200441980 Y:3221708-3221730 CCCCTTGGGCACATGTTCTCAGG - Intergenic
1200456539 Y:3400919-3400941 CGCTTTGGGCACATATTCTCAGG - Intergenic
1200484680 Y:3752788-3752810 CACCTTGGGCACATGTTCTCAGG + Intergenic
1200550709 Y:4576485-4576507 CACCTTGGGCACATGTTCTCAGG + Intergenic
1200551694 Y:4585851-4585873 CACCTTGGGCACATGTTTTCAGG + Intergenic
1200606731 Y:5273380-5273402 CACCTGGGGCACATGTTCTCAGG - Intronic
1200609944 Y:5316093-5316115 CACCTTGGGCACATGTTCTCAGG - Intronic
1200611671 Y:5332298-5332320 CACCTTGGGCACACGTTCTCAGG + Intronic
1200660268 Y:5948397-5948419 CACCTTGGGTACATGTTCTCAGG + Intergenic
1200730609 Y:6734582-6734604 CACCTTGGGCACATGTTCTCAGG - Intergenic
1200801518 Y:7391491-7391513 CACTTTGGGGACATATTCTCAGG + Intergenic
1200813709 Y:7509964-7509986 CACCTTGGGCACATGATCTCAGG + Intergenic
1200979196 Y:9246338-9246360 CATCTTGGGCACATGTTCTGAGG + Intergenic
1201276253 Y:12301488-12301510 CACACTGGGCACATGTTCTCAGG + Intergenic
1201276759 Y:12305844-12305866 CACCTTGGGCACTTGTTCTCAGG - Intergenic
1201286177 Y:12380645-12380667 CACCTTGAGTACATGTTCTCAGG - Intergenic
1201297613 Y:12477723-12477745 CACCTTGGGCACATGTTGTCAGG + Intergenic
1201318119 Y:12668170-12668192 CACCTTGGACACATGTTCTCAGG - Intergenic
1201328882 Y:12797270-12797292 CACCTTGGGCACATGTTCTCAGG - Intronic
1201433830 Y:13934189-13934211 CACCTTGGGCACATGTTCTTAGG + Intergenic
1201472259 Y:14346438-14346460 CACCTTAGGCACATGTTCTCAGG + Intergenic
1201700804 Y:16879372-16879394 CACCTTGGGCAGATGTTCTCAGG - Intergenic
1201701444 Y:16886699-16886721 CACCTTGGACACATGTTCTCAGG + Intergenic
1201725356 Y:17144368-17144390 CACCTTGGGCACATGTTCTCAGG - Intergenic
1201854889 Y:18530433-18530455 AACCTGGAGCACATGTTCTCAGG - Intergenic
1201878432 Y:18789952-18789974 AACCTGGAGCACATGTTCTCAGG + Intronic
1201891076 Y:18944849-18944871 CACCTTGGGCTCATGTTCTCAGG - Intergenic
1201891735 Y:18949844-18949866 CACCTTGAGCACATATTCTCAGG - Intergenic
1201933536 Y:19380440-19380462 CACTTTGGGCACATGTGGTCAGG + Intergenic
1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG + Intronic
1202132169 Y:21622804-21622826 CATCTTGGGCACATGTTCTGAGG - Intergenic
1202173034 Y:22071469-22071491 CACCTGGGGCACATGTTCTCAGG + Intergenic
1202218326 Y:22514902-22514924 CACCTGGGGCACATGTTCTCAGG - Intergenic
1202324859 Y:23681153-23681175 CACCTGGGGCACATGTTCTCAGG + Intergenic
1202387702 Y:24341082-24341104 CACCTTGGACACATGTTCTCAGG - Intergenic
1202483084 Y:25329046-25329068 CACCTTGGACACATGTTCTCAGG + Intergenic
1202545912 Y:25988901-25988923 CACCTGGGGCACATGTTCTCAGG - Intergenic