ID: 1058127058

View in Genome Browser
Species Human (GRCh38)
Location 9:101207322-101207344
Sequence GAGGGCAATAATAATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058127058_1058127061 2 Left 1058127058 9:101207322-101207344 CCTGCAGTATTATTATTGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 95
Right 1058127061 9:101207347-101207369 CACTTTAGTTGTACCTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058127058 Original CRISPR GAGGGCAATAATAATACTGC AGG (reversed) Intronic
901594046 1:10370671-10370693 GACAACAATAATAATAATGCAGG + Intronic
904434963 1:30488826-30488848 GATGGCAATAATAATAATGGTGG + Intergenic
904940095 1:34159652-34159674 AATGGGAATAATAATACTGCAGG + Intronic
907851457 1:58259022-58259044 AAGTGAAATAATAATAATGCTGG + Intronic
918114840 1:181486669-181486691 GAGGATAATAATAATAATACTGG + Intronic
919035516 1:192303369-192303391 GAGGTCAAAGATAATAATGCAGG - Intergenic
921540506 1:216408702-216408724 AAGTGCAATAATAGTAATGCTGG - Intronic
924668740 1:246101492-246101514 GAGTGTGATAAAAATACTGCAGG - Intronic
1064634235 10:17347439-17347461 GAGGGCAATGATAATAATGAAGG + Intronic
1073637346 10:105213464-105213486 GATGGTGATAATAATGCTGCTGG + Intronic
1074001250 10:109375643-109375665 GGGGATAATAATAATACTGGTGG - Intergenic
1076403674 10:130198692-130198714 GAGGGAAAAAAAAATTCTGCTGG - Intergenic
1077695523 11:4389473-4389495 GAGGGGAATAAAAATGATGCAGG - Intronic
1077878386 11:6326843-6326865 GAGGGGAATAATAGTACTAGAGG + Intergenic
1078050270 11:7959714-7959736 GAGGGCAAAGATAATATAGCAGG - Exonic
1079126048 11:17719461-17719483 GAGGCCAATAGGAACACTGCGGG - Intergenic
1085366820 11:75955411-75955433 TAGGGTAATAATAATAATGTTGG + Intronic
1087500501 11:98945758-98945780 CAGGGCATTAATGATACTGCAGG - Intergenic
1091519072 12:1217782-1217804 GAAGGGAGTAATTATACTGCTGG - Intronic
1093294831 12:17376397-17376419 GAGGGCTAGAATAATGATGCAGG + Intergenic
1095237353 12:39813143-39813165 GAGGGCAAAAGTAATACTATAGG - Intronic
1097049447 12:56212920-56212942 GAGGGCAATAAGGATCCTGGAGG + Intronic
1099591366 12:84595170-84595192 CAGGGCAATGATAATAATGGTGG - Intergenic
1103307383 12:119976196-119976218 GAGAACAATTACAATACTGCTGG - Intergenic
1105954684 13:25269201-25269223 GAGGGCAATTATAATGTTCCAGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107669953 13:42734968-42734990 CAGGGCCATAATAAAACAGCAGG + Intergenic
1111446696 13:88355557-88355579 CAGTGGAATAATAATACAGCTGG + Intergenic
1117571576 14:57054288-57054310 AAGGGCAATTATAATACAGTGGG - Intergenic
1126135081 15:45382192-45382214 GAGGACAAGAATAATTCTGTGGG + Intronic
1126353173 15:47766334-47766356 GAAGGGAATAATAATACTTAAGG + Intronic
1126421707 15:48480569-48480591 AAGGGCAATAATATTATTGTTGG - Intronic
1126687000 15:51257108-51257130 GAGGGCAGTATTGATGCTGCAGG - Intronic
1133624876 16:7562016-7562038 GAGGAAAAAAAAAATACTGCAGG + Intronic
1147534805 17:41312997-41313019 GAAGACATTAATAATACTGCTGG + Intergenic
1203164675 17_GL000205v2_random:82962-82984 TAGGGCAATAATCATATTGGAGG + Intergenic
1153931399 18:9882713-9882735 TTGGGCAATTATAAAACTGCTGG - Intergenic
1156174267 18:34523692-34523714 GAGGGAAATAAAAATTGTGCAGG + Intronic
1156758634 18:40559388-40559410 GAGGATAATAATAAATCTGCTGG + Intergenic
1157825336 18:50807045-50807067 GAGGGCAATAAAGATAGTGCAGG + Intronic
1162184802 19:8896540-8896562 GATGACAATAATACTACTGATGG - Intronic
925946465 2:8868525-8868547 GATGCCATTAATAATGCTGCAGG - Exonic
925957339 2:8980162-8980184 GAGGGCAAGAGTAATATTTCAGG - Intronic
941067820 2:160922955-160922977 GAGTGCATAAAGAATACTGCTGG - Intergenic
941189246 2:162356453-162356475 CATGGCAATCATAATTCTGCAGG - Exonic
941733832 2:168949947-168949969 GAGGGCAGGAAGAATACAGCAGG - Intronic
943084276 2:183293925-183293947 CAGGGCAATAATCAAAATGCTGG - Intergenic
943980017 2:194538214-194538236 TTGGGCAATAATACTACTGAAGG + Intergenic
944070633 2:195664690-195664712 GAGTGCTATGATCATACTGCTGG + Intronic
946096088 2:217275057-217275079 GATGGTATTAATAATACTGTAGG - Intergenic
946821404 2:223633683-223633705 AATGGGAATAATACTACTGCAGG - Intergenic
1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG + Intergenic
1175160364 20:57003671-57003693 GAGGGCAATAAGAGCCCTGCAGG - Intergenic
1176407082 21:6376125-6376147 TAGGGCAATAATCATATTGGAGG - Intergenic
1178163231 21:29942558-29942580 GAGGATAATAATAACACTACAGG + Intergenic
1182797126 22:32999189-32999211 GAGGTCGATATTAACACTGCAGG + Intronic
1185304686 22:50107955-50107977 GTGGTTAATAATAATACTTCAGG + Intronic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950975154 3:17233623-17233645 GTAGGCAATGATAATACTGTAGG + Intronic
952818675 3:37467362-37467384 GAAGGAAATAATAATTCAGCAGG + Intronic
956489523 3:69755876-69755898 GAGAGCAATAATCATAGTACAGG - Intronic
959811507 3:110625588-110625610 GAGGGCTATATTCAGACTGCAGG + Intergenic
963263745 3:143218576-143218598 GAGGGGAATAATTAAGCTGCAGG + Intergenic
963905824 3:150772988-150773010 AATGGCAATAATCATACTGGTGG + Intergenic
965319742 3:167238310-167238332 GAGGGCAGTAATAATTGTGGAGG + Intergenic
967788797 3:193525418-193525440 AAGGGAAATAATAATACTGGGGG - Intronic
972184663 4:36514019-36514041 GAGGCCAAGAATATTACTCCAGG + Intergenic
973848075 4:54933457-54933479 GAGAGAAAAAATAATAATGCAGG - Intergenic
974017182 4:56657917-56657939 GAGGGCAGTAGTCATAATGCAGG + Intronic
975644788 4:76535511-76535533 GATGACAATAATAATACTTAAGG + Intronic
976715473 4:88118824-88118846 GAGGGTAATAATAATAATATTGG - Intronic
976804207 4:89027677-89027699 AAGCGCAAGAATAATAATGCTGG - Intronic
977669827 4:99683100-99683122 GAAGACAATAAAAATACTTCTGG + Intergenic
979023253 4:115530413-115530435 GAGGGGAATAATAATGATGATGG + Intergenic
979660576 4:123249550-123249572 GAAGGAAAGAATAAGACTGCAGG + Intronic
981048878 4:140291770-140291792 GGGGGCTGTGATAATACTGCAGG + Intronic
983093935 4:163540055-163540077 GTGGGCATTTATAATACAGCTGG + Intronic
991417860 5:66410198-66410220 GCTGGCATTAATAATGCTGCAGG - Intergenic
995229403 5:109741725-109741747 GAGTTGAATAATAATGCTGCTGG - Intronic
995549141 5:113263613-113263635 GACTGCAATAATTTTACTGCAGG + Intronic
999293254 5:150441439-150441461 GAGGGCAGTGATAAAACAGCAGG + Intergenic
1001506727 5:172285465-172285487 GAGGACAATACTAATTCTTCAGG - Intergenic
1008266427 6:49432731-49432753 AAGGGCACAAATAATACTGCAGG + Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1011670215 6:89676149-89676171 GAGAGCGATAAAAATACTTCTGG + Exonic
1012159011 6:95859506-95859528 GAGGGCAAAAATAATGATGCTGG + Intergenic
1018882300 6:167896481-167896503 AAGGGCAGCAAGAATACTGCAGG + Intronic
1019652026 7:2165040-2165062 GTGGGCAATACAAATACGGCTGG + Intronic
1020482686 7:8681600-8681622 AAGGGCAATTACAATACTTCAGG + Intronic
1020535516 7:9391384-9391406 GAGGGCTATAAAAATAAGGCTGG + Intergenic
1025271949 7:57530213-57530235 GAAGGGAAAAATAACACTGCAGG + Intergenic
1031174794 7:118336956-118336978 GAGGGCAATTATAATTTTTCTGG + Intergenic
1037625567 8:20603463-20603485 GAAAGCTAAAATAATACTGCAGG - Intergenic
1041018959 8:53618903-53618925 GAGGGAAAAAAGAAAACTGCTGG + Intergenic
1042798669 8:72692917-72692939 AAGTCCAATAATAATACTGCTGG + Intronic
1043567309 8:81562272-81562294 AAGGGCTATAGTGATACTGCCGG - Intergenic
1048249566 8:132851213-132851235 CAAGGCAATAATAATAGTGCTGG + Intergenic
1049817004 8:144609070-144609092 GTGTTCAGTAATAATACTGCAGG - Intergenic
1052050159 9:23837275-23837297 GAGGGCTTTAAAAACACTGCTGG + Intergenic
1052780898 9:32781653-32781675 GAGGACAATAATAATTTTCCTGG - Intergenic
1056370966 9:85953728-85953750 GTAGTCAATAATAATACTGTAGG - Intronic
1058127058 9:101207322-101207344 GAGGGCAATAATAATACTGCAGG - Intronic
1058282609 9:103134487-103134509 GAGGTCATTATTAATACGGCTGG + Intergenic
1058406838 9:104686309-104686331 GAGGGTAATAACAATATTGGAGG - Intergenic
1059333882 9:113556468-113556490 GAGGATAATAACAATAGTGCTGG - Intronic
1185912813 X:4000981-4001003 TAGGGCAATAATAAGACTGTGGG + Intergenic
1188590807 X:31832521-31832543 GAGGGCAATTATAATCTTCCAGG - Intronic
1189089933 X:38071185-38071207 GAGGGTAGAAATAATACTGAAGG + Intronic
1192765148 X:74132430-74132452 CAGGGCAAGAATAAGACTGCAGG - Intergenic
1199527970 X:148812972-148812994 GAGGGCAAGAAGAAAATTGCTGG - Intronic