ID: 1058127185

View in Genome Browser
Species Human (GRCh38)
Location 9:101208466-101208488
Sequence GTAAACACTCTTACCTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058127184_1058127185 17 Left 1058127184 9:101208426-101208448 CCTAGGCTTTGCATTTTCGTCAA 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1058127185 9:101208466-101208488 GTAAACACTCTTACCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058127185 Original CRISPR GTAAACACTCTTACCTCTTT TGG Intronic
No off target data available for this crispr