ID: 1058130368

View in Genome Browser
Species Human (GRCh38)
Location 9:101245801-101245823
Sequence TACAGACCATGTTAGTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058130368 Original CRISPR TACAGACCATGTTAGTTCTT TGG (reversed) Intronic
911211525 1:95143435-95143457 TACAGGCAGTGTTAGTTCTATGG + Intronic
912998003 1:114551063-114551085 TAGAGACGATGAAAGTTCTTTGG - Intergenic
914849525 1:151303764-151303786 TACACACCATGTTGGTTACTGGG + Intronic
922248841 1:223827640-223827662 TACAGACCATTTTAATTGATGGG + Intronic
922253741 1:223873626-223873648 TACCAAGTATGTTAGTTCTTGGG + Intergenic
923013909 1:230110880-230110902 GACAGACCATGGGAGTTCTGGGG + Intronic
1063557996 10:7099008-7099030 TGCAAAACCTGTTAGTTCTTAGG + Intergenic
1064356247 10:14621135-14621157 TAAAGACCATTTTATTTCTTAGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066561630 10:36675992-36676014 TAAAAACCATTTTATTTCTTAGG - Intergenic
1069062395 10:63907657-63907679 TACAGGCCATGTCAGTTATCTGG - Intergenic
1069622698 10:69847629-69847651 TACAGACCCTGTTATTTATTGGG - Intronic
1069712946 10:70501358-70501380 GCCAGACCAGGTTAGTTCTCAGG - Intronic
1072979138 10:100085186-100085208 TACTCACCATGTTAGGTGTTGGG + Intergenic
1073605917 10:104895489-104895511 TACAGTACATGAGAGTTCTTAGG - Intronic
1074924168 10:118049909-118049931 TACATACCATGTTACTTCTTGGG - Intergenic
1079051684 11:17166330-17166352 TAAAAAGCATGTAAGTTCTTGGG + Intronic
1080330867 11:31136432-31136454 TAGAGACCATATTAGTATTTGGG - Intronic
1080974014 11:37313509-37313531 TACAAACCATCTTAGTATTTAGG + Intergenic
1081039064 11:38187664-38187686 TAAAGAACATGTTATTTATTCGG + Intergenic
1082066586 11:47905722-47905744 TTCAGACCAAGTGAGTTCTTGGG + Intergenic
1085025189 11:73232319-73232341 TACAGATCATGTAAGTTATTTGG - Intronic
1086729846 11:90235399-90235421 AAAAGACCATTTTAGGTCTTCGG - Intergenic
1090091602 11:123703017-123703039 CACAGACCATGTAAGGGCTTGGG + Intergenic
1090439776 11:126715966-126715988 TACACCCAATGTTAGTTCTTAGG + Intronic
1093204843 12:16235699-16235721 TACATACCATGATGTTTCTTGGG + Intronic
1095786568 12:46116054-46116076 TAAAGACCATGTAGGGTCTTAGG - Intergenic
1098714342 12:73810697-73810719 TACAGTCCCTGTTTGGTCTTTGG + Intergenic
1099581626 12:84455026-84455048 TTTAGAGCATGTTACTTCTTTGG + Intergenic
1100249414 12:92801509-92801531 TATAAAGCATGTTTGTTCTTGGG - Intronic
1101503160 12:105322705-105322727 TACACACCATCTTAATACTTAGG - Intronic
1106564513 13:30872854-30872876 TACAGGCCAAGTTTTTTCTTGGG - Intergenic
1106736380 13:32591831-32591853 CTCAGACCATCTTAGCTCTTAGG - Intronic
1107684618 13:42884887-42884909 TACAAAAAATGTGAGTTCTTAGG + Intergenic
1109142544 13:58733337-58733359 TACATACCCTATTGGTTCTTTGG - Intergenic
1109405656 13:61895169-61895191 TACACACAAAGTCAGTTCTTTGG - Intergenic
1110206665 13:72922493-72922515 CAAAGACCATGTTAGTGCCTGGG - Intronic
1112092754 13:96099377-96099399 TAAAGTCAATGTTAATTCTTAGG + Intronic
1121458586 14:94055485-94055507 CACAGACCATGTTAATCCCTGGG + Intronic
1122202552 14:100131336-100131358 TGCAAAGCATGTTTGTTCTTGGG - Intronic
1122958994 14:105086006-105086028 TAGAGTCCATTTTAGCTCTTGGG - Intergenic
1124162367 15:27284010-27284032 TACAGATGAGGTGAGTTCTTTGG - Intronic
1125284362 15:38075880-38075902 TACAGACTTTCTTAGTTCTGTGG - Intergenic
1131497346 15:92924078-92924100 TACAGAACAGGTTATTTCTATGG - Intronic
1132226221 15:100143708-100143730 TACAGTCCATATTAATTCTTAGG - Intronic
1139002616 16:62531505-62531527 TACAAATCATCTTAGATCTTTGG - Intergenic
1147658364 17:42103867-42103889 TACAAATGATCTTAGTTCTTTGG - Intronic
1148580863 17:48742803-48742825 AACAGACCATGTTCTTTCTTTGG - Intergenic
1152987055 18:330614-330636 TACAGTCATTGTTAGATCTTTGG + Intronic
1157752422 18:50191521-50191543 TACATTGCATGTTAATTCTTAGG - Intronic
1157835255 18:50895913-50895935 TACTAACCTTGTTTGTTCTTGGG - Exonic
1158641300 18:59206425-59206447 TAAAGGCCATGTTAGTACTATGG + Intergenic
1164742443 19:30585859-30585881 TACAGACAATGAAAGTTCCTTGG - Intronic
1166341761 19:42141821-42141843 TAGTGAACATGTTTGTTCTTAGG - Intronic
929234902 2:39595230-39595252 TACAGACAATGGAAGTTCTGGGG + Intergenic
931313824 2:61107187-61107209 TAAAGACCATGTTATGTTTTGGG - Intronic
932209044 2:69912248-69912270 AATAGACCATGTTCGTTCCTTGG - Intronic
933057153 2:77684656-77684678 TACAGTCCATGTGAGGTCTGAGG - Intergenic
933589354 2:84214702-84214724 TACAGGCCATGCCAGTTCCTGGG + Intergenic
933927284 2:87105795-87105817 TACAGTCCATGTGAGGTCTGAGG - Intergenic
936269664 2:111040224-111040246 CACAGACCATGTTGGTCCTATGG + Intronic
936961986 2:118085696-118085718 TACAGACCATTCTACTTTTTTGG - Intergenic
944448588 2:199817913-199817935 TACATATCAAGTTTGTTCTTAGG + Intronic
945959380 2:216116489-216116511 TACAGACAATGACAATTCTTAGG - Intronic
1170518140 20:17153281-17153303 TGTAGACCATGTTTCTTCTTTGG + Intergenic
1171938695 20:31302803-31302825 AACATACCAGGTTAGTTCTCTGG + Intergenic
1173005168 20:39134652-39134674 TACAATCCATGTCAGCTCTTTGG + Intergenic
1173096141 20:40030399-40030421 TAGATACCATGTTAGATGTTGGG - Intergenic
1178143027 21:29705721-29705743 TACAGACCATCTTAATGCTTAGG - Intronic
1178787967 21:35672022-35672044 TAGGGACAATGTGAGTTCTTAGG - Intronic
1179161227 21:38901039-38901061 GCCAGACCATGTAAGGTCTTGGG - Intergenic
952260019 3:31730819-31730841 TTTAGAACATGTTAGGTCTTTGG - Intronic
952796822 3:37246405-37246427 TACAGACATTGTAATTTCTTGGG + Intronic
956828146 3:73018031-73018053 TACAGACCAGGTTGGTTTTGGGG + Intronic
957479151 3:80769506-80769528 TATAGGCCATGTTAATTATTGGG + Intergenic
958009307 3:87855665-87855687 TTCAGACCATGTTAGGTTATGGG - Intergenic
959367406 3:105479797-105479819 TAAACACCATGTAAGTTCATAGG - Intronic
959509367 3:107192547-107192569 TGCAAACCATGTTAATACTTTGG + Intergenic
959760569 3:109958822-109958844 TACAAAACCTGTGAGTTCTTAGG + Intergenic
964084006 3:152794412-152794434 TAAACACCATGTTCTTTCTTGGG - Intergenic
965313576 3:167162357-167162379 TGAAGGCCATGTTTGTTCTTGGG - Intergenic
969139390 4:5055427-5055449 GACAGACCATGTAAGGACTTAGG - Intronic
970567313 4:17345071-17345093 TGCAGGCCATGTTAGTTGATTGG - Intergenic
976837958 4:89397534-89397556 TTCAGATCATGTAACTTCTTTGG - Intergenic
977024031 4:91792395-91792417 TACAGAACATTTTATTTGTTTGG - Intergenic
977452380 4:97215289-97215311 TACAGAACTTGCTAGTTCTCAGG + Intronic
982071939 4:151703124-151703146 GACAGACAATGGGAGTTCTTGGG + Intronic
995337856 5:111022931-111022953 TGTAGACAATGTAAGTTCTTAGG - Intergenic
996046599 5:118881387-118881409 TATAAGCCATGTTATTTCTTAGG - Intronic
1000136724 5:158360574-158360596 TACAGAGCATGTGAGTTCCCAGG - Intergenic
1000734905 5:164886730-164886752 TACTGACCTTGTTTGTTCATAGG + Intergenic
1002894929 6:1372734-1372756 TTCATATCATGTTAATTCTTTGG + Intergenic
1003463393 6:6353090-6353112 TACAGTCCATATTAGTAATTTGG + Intergenic
1004465319 6:15879949-15879971 CACAGACCATTTTAGTCATTAGG - Intergenic
1005206103 6:23406706-23406728 TACAGACCACTGTAGTTTTTAGG - Intergenic
1006369636 6:33635901-33635923 TTCAGGCCATGTAAGTTCTTTGG + Intronic
1007725764 6:43914820-43914842 CACAGCCCATGGTATTTCTTAGG + Intergenic
1007831551 6:44642687-44642709 TACAGACAACTTTAATTCTTTGG + Intergenic
1023935579 7:44737593-44737615 TGCAGACCCTGTCAGGTCTTGGG + Intergenic
1028147645 7:87336123-87336145 TAAACACCATGGTAGTGCTTTGG - Intergenic
1029845999 7:103412918-103412940 TAATGACCATGCTATTTCTTTGG + Intronic
1032869210 7:135963871-135963893 TACACACCATTTTTCTTCTTTGG + Intronic
1033607097 7:142935677-142935699 TCCAGACCTTGTTGCTTCTTGGG + Intergenic
1035988674 8:4463522-4463544 TATAGACCATGTTTTTTCATCGG - Intronic
1044681947 8:94788533-94788555 TAAAAGCCATGTTAGTTGTTAGG + Intronic
1048159118 8:131995449-131995471 TAGAGACCCTGTTAGGTGTTAGG - Intronic
1050662787 9:7901646-7901668 TTGAGACGATGTTAGTGCTTTGG + Intergenic
1050724818 9:8636737-8636759 TCCAGACAATTTTAGGTCTTGGG + Exonic
1052844125 9:33319808-33319830 TACTTACAATTTTAGTTCTTTGG - Intronic
1053380023 9:37641161-37641183 TACAGACCATGTTATTTTTATGG + Intronic
1057083018 9:92186993-92187015 AACAGAACCTGATAGTTCTTCGG + Intergenic
1057522475 9:95771090-95771112 TAATGACCATGTTACTACTTAGG - Intergenic
1058130368 9:101245801-101245823 TACAGACCATGTTAGTTCTTTGG - Intronic
1058904698 9:109473240-109473262 TACAGACCCTGTAATTTGTTCGG + Intronic
1203760363 EBV:9968-9990 CAAAGACCATGTCAATTCTTTGG + Intergenic
1194142156 X:90220339-90220361 TACAGTCCATGTTAGTTGGGTGG + Intergenic
1194746984 X:97638963-97638985 TACAGACAATGTAGGTTGTTAGG - Intergenic
1198672057 X:139091607-139091629 CACAGACAATGTGAGTTCTGAGG + Intronic
1200487910 Y:3789438-3789460 TACAGTCCATGTTAGTTGGGTGG + Intergenic
1201964535 Y:19717307-19717329 AACACACCACCTTAGTTCTTCGG - Intronic
1202336125 Y:23812863-23812885 TACAGTTTATGTTAGTACTTAGG + Intergenic
1202534641 Y:25857204-25857226 TACAGTTTATGTTAGTACTTAGG - Intergenic