ID: 1058133021

View in Genome Browser
Species Human (GRCh38)
Location 9:101274849-101274871
Sequence CTGAACCCACAGAAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058133021_1058133025 10 Left 1058133021 9:101274849-101274871 CCATGTTCCTTCTGTGGGTTCAG 0: 1
1: 0
2: 1
3: 16
4: 296
Right 1058133025 9:101274882-101274904 TGTACCCAAAAGAAATGGTTAGG No data
1058133021_1058133024 5 Left 1058133021 9:101274849-101274871 CCATGTTCCTTCTGTGGGTTCAG 0: 1
1: 0
2: 1
3: 16
4: 296
Right 1058133024 9:101274877-101274899 TCATCTGTACCCAAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058133021 Original CRISPR CTGAACCCACAGAAGGAACA TGG (reversed) Intronic
900300128 1:1973018-1973040 CTGAACACCCAGAAGGAGCTCGG - Exonic
901505203 1:9680761-9680783 CTGGCCCCACAGCAGGAACGCGG + Intronic
902041390 1:13495082-13495104 CTGAGACCACAGAAGGGTCAGGG + Intronic
902844403 1:19098463-19098485 GTGAACCCACAGAATGCACCAGG - Intronic
903681501 1:25100583-25100605 CTTAACCCACACAAGGCAGAAGG - Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905908906 1:41640411-41640433 TTGCACCCAGAGAGGGAACACGG - Intronic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
908732279 1:67238489-67238511 CTGATCCCACAGAAATATCAAGG - Intronic
911697146 1:100902635-100902657 CTGAAGCTACAGAAAGATCATGG - Intronic
911736958 1:101347501-101347523 CTGATCCCACAGAAATAAAAAGG - Intergenic
912662959 1:111550357-111550379 CTGAACCCAAAGCAAGAAAAAGG - Intronic
913529545 1:119723976-119723998 ATGAACCCACAGAACACACAAGG - Intronic
916980544 1:170131572-170131594 ATGAGACCACAGAAGTAACAGGG - Intergenic
917398636 1:174621527-174621549 CAGAGCCCTCAGAAGTAACACGG + Intronic
918168179 1:181970476-181970498 CTGCACCCAGAAAGGGAACAAGG - Intergenic
918707928 1:187691617-187691639 CCAAACCCACAGAATGTACAAGG + Intergenic
919551248 1:198990861-198990883 CTGAACCCTCATACCGAACACGG + Intergenic
919626931 1:199920204-199920226 GTGAACCCACAAAAGAAACAGGG + Intergenic
920110182 1:203582199-203582221 GGGAACCCCCAGAAGGAGCAAGG + Intergenic
920832346 1:209477135-209477157 CTGATCCCACAGCAAGAATAGGG - Intergenic
920967372 1:210712180-210712202 CAGAATCCATAAAAGGAACATGG + Intronic
921349297 1:214219163-214219185 CTGAACCCTCAGATGGAATGAGG + Intergenic
921646284 1:217622235-217622257 CTGAATCAACACAAGGGACAGGG + Intronic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
923613629 1:235518007-235518029 CTCAACATACAGAATGAACAAGG - Intergenic
924019851 1:239769582-239769604 CTAAACCTACAGGAGGAAAATGG - Intronic
1062989779 10:1804570-1804592 CTGTAGCCACAGAAACAACAGGG + Intergenic
1063033900 10:2266469-2266491 CTGACACCACAGAAAGGACAGGG + Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1064791670 10:18963251-18963273 CTGAGCCCACACAAGGAAATAGG + Intergenic
1065600084 10:27359216-27359238 CTGAACACACAGGAGGCACTGGG + Intergenic
1065832320 10:29625995-29626017 CTGAACTCACAGAAACAAAATGG + Intronic
1066581927 10:36890678-36890700 CTGAACACACAGGAGGAACTCGG - Intergenic
1067687386 10:48475221-48475243 CTGAGCCAAGTGAAGGAACAAGG - Intronic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069566065 10:69464335-69464357 CACAACCCACAGAAGGAAGGTGG - Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070392461 10:75983242-75983264 CTAAAACCATAGCAGGAACAAGG + Intronic
1070588775 10:77786815-77786837 CTGAAGCTCCAGAAAGAACAGGG + Intergenic
1070689114 10:78511654-78511676 ATGACCCAACAGGAGGAACAGGG + Intergenic
1070808610 10:79285990-79286012 CTCCACCCACAGAAGCACCAAGG - Intronic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072436935 10:95422544-95422566 CTGAGCCCACAGCAGGCTCAAGG - Intronic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1074258593 10:111829169-111829191 ATGAAACCTCAGAAGGAACTTGG - Intergenic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1075879250 10:125835887-125835909 TTAAACCCACATGAGGAACAGGG - Intronic
1076031017 10:127158539-127158561 CTGAACGCCCAGAAGGTACCAGG - Intronic
1077854803 11:6113087-6113109 GTGAACCCACATAGGAAACATGG - Intergenic
1079111425 11:17607318-17607340 CTGAACACACAGCCTGAACAGGG - Intronic
1079913521 11:26339677-26339699 ATGAAGTCACAGAAGGGACAGGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1084134360 11:67165020-67165042 CTGAACACATAGAAGGAAAGAGG + Intronic
1084698538 11:70770770-70770792 CTGATCCCAGAGCAGGAACCTGG - Intronic
1085150548 11:74249544-74249566 CTGATCTAACAGAAAGAACAGGG + Intronic
1085585903 11:77705694-77705716 CTGGACCCAAAGAAGGGAAAAGG - Intronic
1089073798 11:115721056-115721078 CAGATCCCAGAGTAGGAACAAGG + Intergenic
1089325179 11:117652058-117652080 CCGAACCCTGAGAAGGAAGATGG - Intronic
1089329590 11:117680322-117680344 CTGCACCCACAGGAGGGTCAGGG - Intronic
1090977282 11:131688669-131688691 CTCAACCCACAGCATGAACTGGG - Intronic
1091664794 12:2411463-2411485 TTTAGCCCACAGAAGGAGCAGGG - Intronic
1091704759 12:2686195-2686217 CTGAAGCGACAGAAGGACCGAGG + Exonic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1095311887 12:40708223-40708245 CTAAACCCACAAAAGCTACAAGG - Intronic
1097224816 12:57471058-57471080 CTGACCCCACCCAAGAAACATGG + Exonic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099437047 12:82657754-82657776 CAGAACCCAAAGGATGAACAAGG - Intergenic
1101438070 12:104680830-104680852 CTTCACTCACAGCAGGAACAGGG - Intronic
1101570406 12:105948356-105948378 CTGAACCCACAGAGTGGGCAAGG - Intergenic
1102042283 12:109808570-109808592 CTGAAGCCTTACAAGGAACAGGG + Intronic
1103871802 12:124097587-124097609 CAGAAGCCAGTGAAGGAACATGG - Intronic
1104287815 12:127441189-127441211 CTGAACTCCTAGAAGGAAAATGG + Intergenic
1104316360 12:127706143-127706165 CAGAAATCACAGAAGGAACCCGG - Intergenic
1104465009 12:128983253-128983275 CTGAACGCACAGAAGGATATGGG - Exonic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1107298003 13:38933745-38933767 CTTATCCCACAGAAGTAACTTGG - Intergenic
1109495939 13:63171936-63171958 TTAAACCTGCAGAAGGAACATGG - Intergenic
1109559746 13:64030910-64030932 ATGCTCCCACAGAAGAAACAGGG + Intergenic
1110401054 13:75092621-75092643 CTGAAGCCAGAGCAGGAGCACGG + Intergenic
1111068370 13:83128590-83128612 CTGCACCCAAAAAAGGCACAGGG + Intergenic
1112446888 13:99472270-99472292 CAGCACCCAAAGAAGGAACTGGG - Intergenic
1113738222 13:112692965-112692987 GTGAACACCAAGAAGGAACAGGG - Intronic
1114297735 14:21345121-21345143 CTGGACCCACAGGAGCAGCAAGG + Exonic
1114376066 14:22148108-22148130 CTGAATCCAAAGAATGGACACGG - Intergenic
1117263881 14:54065595-54065617 CAAAACCCACAGTAGGAAGATGG - Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1118175320 14:63433883-63433905 CTGAACCCAAAGCAGCAGCAAGG - Intronic
1118629301 14:67688168-67688190 CTGAACCCTCAGACTGAATAAGG + Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121317057 14:92968534-92968556 GTGAAGTCAGAGAAGGAACAAGG + Intronic
1121595766 14:95160984-95161006 CTGAGCCCAAAGAAGGAAGGTGG + Intergenic
1126446914 15:48757579-48757601 CTGAATTCAAAGAAGGCACAAGG + Intronic
1128568714 15:68718143-68718165 GTGAACCCACACAGGAAACATGG + Intronic
1128792980 15:70446768-70446790 CTGAACTGAGAGAAGGAAAAGGG - Intergenic
1129518915 15:76173452-76173474 CTGAACCCACAGAACCACCAAGG + Intronic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1131187259 15:90285518-90285540 CTGAACCCACAGAAAGATGTGGG - Intronic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132401776 15:101513588-101513610 CTAAGCCCACAGAATGTACAGGG - Intronic
1134060195 16:11194918-11194940 CAGAAGCCACAGCAAGAACAGGG + Intergenic
1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG + Intergenic
1137671707 16:50283107-50283129 CTGAACCCACTGAGGGGCCACGG + Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141777857 16:86136243-86136265 CAGAACCCACTGCAGGGACATGG - Intergenic
1142735618 17:1896990-1897012 CTGAAACCACTGAAGCAAAAGGG + Intronic
1143333027 17:6151718-6151740 CTGAAACCCCAGTAGGCACACGG - Intergenic
1143782768 17:9238076-9238098 CTGCACCCACACATGGACCAGGG - Intronic
1144250136 17:13408026-13408048 CCCAAGCCACAGAAGGGACAAGG - Intergenic
1144586390 17:16490424-16490446 CTGAACTCAGAGAAGGCACATGG + Intronic
1145393882 17:22478575-22478597 TTGAGACTACAGAAGGAACAGGG + Intergenic
1146219725 17:31008163-31008185 TTGAACAGAAAGAAGGAACAAGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147443543 17:40461741-40461763 TTCAACCCACAGAAGAAAGAAGG - Intergenic
1149440992 17:56673702-56673724 CTAAAGCCACAGAATAAACAGGG + Intergenic
1150601798 17:66657473-66657495 CTGAACACCCAGCAGGGACATGG + Intronic
1152720509 17:81921331-81921353 CTAAACCCAAAAAACGAACACGG + Exonic
1152848361 17:82616375-82616397 CTGAGCCCACAGGAGAAATAAGG + Intronic
1153599088 18:6761517-6761539 CTGAACCCACAGCATGAATCTGG + Intronic
1153711649 18:7806125-7806147 CTGAACCCACAGTGGAAACTGGG + Intronic
1155107720 18:22684126-22684148 CTGATCCCACAGAAGGGACAAGG + Intergenic
1158994520 18:62904260-62904282 CTGAACCCATAGAAGTAATTAGG + Intronic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160827713 19:1088499-1088521 ATGCAGCCTCAGAAGGAACAAGG - Exonic
1161569367 19:5022142-5022164 CAAAACCCTCACAAGGAACATGG - Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165315686 19:35053993-35054015 TGAGACCCACAGAAGGAACAGGG + Intronic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1165647121 19:37450467-37450489 CTGATGCCACAGAAGTAAAAAGG - Intronic
1165661658 19:37586008-37586030 TAGAACCTCCAGAAGGAACATGG + Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166958012 19:46478745-46478767 CTGAACCCAAAGAAAGTCCAGGG + Intergenic
1167034252 19:46984405-46984427 CTGAGACCACAGCAGGAAAAGGG - Intronic
926173001 2:10565176-10565198 CTGTACCCTCAGGAGGAACTTGG + Intergenic
926203461 2:10817945-10817967 ACGTACCCACAGAATGAACAGGG + Intronic
926330514 2:11821635-11821657 CTAAAACCACAGAAGCTACATGG - Intronic
927000360 2:18788565-18788587 AGTAACCCACAGAAGGAAGAGGG - Intergenic
927236829 2:20882412-20882434 CTGCACCAACAGAGGGAATAGGG - Intergenic
928056323 2:28058959-28058981 CAGCAGCCACAGAAGGCACAGGG - Intronic
928830050 2:35470851-35470873 TTGAACCCACAGAAGCAAAATGG - Intergenic
929429678 2:41876689-41876711 CTGACCTCACAGAAAGAAAATGG + Intergenic
929652092 2:43690443-43690465 GTGAACCCACAGATGAAACCTGG + Intronic
933008549 2:77026417-77026439 TTTAACCCACAGAATGATCATGG + Intronic
933112150 2:78416441-78416463 CTGAGCTCACACATGGAACAGGG + Intergenic
934477854 2:94604795-94604817 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
937253355 2:120538117-120538139 CTGTGCCCAGAGGAGGAACAGGG + Intergenic
937321885 2:120965896-120965918 CTGACCCCACAGAGGGGCCAGGG - Intronic
939846357 2:147251220-147251242 CTGATCCCCCAGAAGGACAAAGG + Intergenic
943370665 2:187011605-187011627 TTGAACCCACTGTAGGAAGAAGG + Intergenic
943952969 2:194154780-194154802 CTGAACCCAAAGAATGGACTTGG + Intergenic
944183809 2:196926394-196926416 ACGAACCCACAGAAGGAAAAAGG + Intronic
946591926 2:221259624-221259646 GTGGACCCAGGGAAGGAACAAGG + Intergenic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
948305010 2:236940254-236940276 GGGAGCCCACAGAAGGACCAGGG + Intergenic
948889214 2:240898657-240898679 CTGAACCTAGGGAAGCAACAGGG + Intergenic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1170612862 20:17928798-17928820 CCGAGGCCCCAGAAGGAACATGG + Intergenic
1171464449 20:25317844-25317866 CCGACCCCACAGCAGGGACATGG + Intronic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173016610 20:39231599-39231621 CTGAGTCCACAGAAGGGAAAAGG - Intergenic
1173355044 20:42279454-42279476 CACAACACTCAGAAGGAACAAGG + Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1176300891 21:5098451-5098473 CTCACCCCACAGAAGGATCTGGG - Intergenic
1178754841 21:35338778-35338800 GTGAAGCCACACAAGGTACAAGG + Intronic
1179533904 21:42039074-42039096 CTGAAACTCCAAAAGGAACACGG + Intergenic
1179856145 21:44163502-44163524 CTCACCCCACAGAAGGATCTGGG + Intergenic
1180943302 22:19674557-19674579 ATGATCCAACAGAAAGAACAAGG - Intergenic
1181083281 22:20427732-20427754 GTGAACCCAGAAAAGAAACATGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183149468 22:36026794-36026816 CTAAATCAACAGAAGTAACAGGG + Intronic
1184541524 22:45128762-45128784 CTGACCTCCCAGAAGGAAGAGGG - Intergenic
950737476 3:15021627-15021649 CTTAAGCCACAGTAGGAAAATGG + Intronic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
951870138 3:27352548-27352570 GTGAACCCACAGAAGGCTCCAGG + Intronic
952759503 3:36901656-36901678 CTGAACCAAAAGAAGGTAGAGGG + Intronic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
955897613 3:63717403-63717425 TAGAACCCCCAGGAGGAACACGG - Intergenic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
955957529 3:64305657-64305679 CAGGTCCCACAGTAGGAACAGGG - Intronic
956129457 3:66039608-66039630 CTGAACCCACACTAGCACCATGG - Intergenic
957072648 3:75578955-75578977 CTGAACCCATTGAAGCAGCACGG - Intergenic
957156987 3:76556326-76556348 CTGAAGCCTCAGAAGGGAAAGGG + Intronic
959502170 3:107119059-107119081 TTGACCCAACAGAAGGAGCATGG - Intergenic
961328438 3:126125236-126125258 CGGAAGCCACATAAGGGACATGG + Intronic
961437768 3:126931278-126931300 CTAAACCAACAAAAGGAAAAAGG - Intronic
961815439 3:129547786-129547808 CTGAGACCACAGGAGGAACAAGG - Intronic
963225365 3:142856603-142856625 CCGAACCCACAGAAGCAGGAAGG + Intronic
963852335 3:150221366-150221388 CTGAACCCACAAAAGAAATCTGG - Intergenic
964741088 3:159966874-159966896 CTGAACTCATAGCAGGAAGAGGG + Intergenic
967294991 3:187955849-187955871 CTGAAACTACAGAACAAACATGG - Intergenic
967363021 3:188653364-188653386 CTGAACCCAAAATAGAAACATGG - Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
967916519 3:194582550-194582572 CTAAACCCACAGCTGGAACAAGG - Intergenic
968054845 3:195683579-195683601 CAGAACCCACAGAGGCCACATGG - Intergenic
969646128 4:8430351-8430373 CTGAATCCCCAGGAGCAACAAGG + Intronic
970939349 4:21613309-21613331 CTGAACCAAGAGAACAAACAAGG - Intronic
971048070 4:22828594-22828616 TCGAACCCACAAAAGGCACATGG - Intergenic
971479902 4:27105163-27105185 CTGATCACATAAAAGGAACATGG + Intergenic
973609242 4:52618609-52618631 CTGAACCCAAGAAAGGAATATGG - Intronic
975321064 4:73011124-73011146 CTGCACCTGCACAAGGAACATGG + Intergenic
981179530 4:141723505-141723527 TAGACCCCTCAGAAGGAACATGG + Intronic
981240172 4:142467283-142467305 CTGCGCCCACAGAAGCCACAGGG + Intronic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
985720183 5:1484840-1484862 CTGAGCCCACAGCAGGAAGGGGG - Intronic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
988486320 5:31670970-31670992 CTGCACCCAATGAAGGAATAAGG - Intronic
989314282 5:40059355-40059377 CAGAAGCCACTGAAGGAATATGG - Intergenic
991054262 5:62305522-62305544 TTGAACCCTCAGCAGAAACAGGG + Intergenic
991094795 5:62728385-62728407 CTGAAACCACAGCAACAACATGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
993198487 5:84781882-84781904 CTGAACCCTGAGAAGCCACAGGG - Intergenic
993680359 5:90870486-90870508 TTGAAGCCAAAGAAGGAAAAAGG + Intronic
994156791 5:96513014-96513036 CTGAAACCACAGAACAATCATGG + Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
994812555 5:104540200-104540222 CTGGACCCAGAGAAGGCAGAAGG - Intergenic
996754287 5:126919859-126919881 CTGAACCCACAGTGGGGAGACGG + Intronic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
999178628 5:149652529-149652551 CTGAGACCACTGAAGGATCATGG + Intergenic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
1001759273 5:174194120-174194142 CTGAATACACAGTAGGGACAGGG + Intronic
1002664705 5:180814565-180814587 ATGATCCCACAGAAGTCACATGG + Intronic
1003635519 6:7828349-7828371 CTGAACACACAAACAGAACAGGG - Intronic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005601320 6:27429200-27429222 ATGAACCTACAGAAGTAATAGGG + Intergenic
1008065417 6:47042527-47042549 CTGAAATCACAGAAGGGAAATGG + Intergenic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1014325434 6:119987077-119987099 CTGAACCCACAGGAGCACCTAGG - Intergenic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1019659791 7:2217848-2217870 CTAACCTCACAGAAGGACCACGG + Intronic
1019949837 7:4362416-4362438 CAGAGACCATAGAAGGAACAGGG - Intergenic
1021605126 7:22402457-22402479 CTCACCCTACTGAAGGAACAAGG + Intergenic
1024827310 7:53406307-53406329 ATGAACCCAAAAATGGAACATGG - Intergenic
1028827583 7:95291101-95291123 CTGAACACACAGCAGTAGCAAGG - Exonic
1029403955 7:100362192-100362214 CTGACCTCACAGAATGAACCTGG - Intronic
1032355017 7:131202953-131202975 GTAAACCCACAGGATGAACAAGG + Intronic
1035048237 7:155983217-155983239 CAGACCCCCCTGAAGGAACAGGG + Intergenic
1035606438 8:933239-933261 CCTAACCCACAGAATGATCAGGG - Intergenic
1035999663 8:4586822-4586844 CTGCACGCACAGTAGGATCATGG + Intronic
1036439773 8:8771499-8771521 CTGACCCCACAGAAATAAAAAGG - Intergenic
1036545115 8:9760662-9760684 CTGAACACACAGGATGAACGCGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037722306 8:21455290-21455312 CTGAACCCACAAAGGGACCTCGG + Intergenic
1037770269 8:21794847-21794869 CTGATCCCAAAGAATGAACAGGG + Intronic
1038848922 8:31255308-31255330 TTGAACCCAAAGAAGGGTCATGG - Intergenic
1039021500 8:33212039-33212061 ATGAACCCACAGGAGGGAGAAGG - Intergenic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1039334258 8:36572737-36572759 TGGAACCCACAGGTGGAACAGGG - Intergenic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039818957 8:41119374-41119396 CTGAATGCACAGCAAGAACAAGG + Intergenic
1042025804 8:64422447-64422469 CTCAACCCACAGAAAGAAACAGG - Intergenic
1043211097 8:77519128-77519150 ATAAACACACAGAAAGAACAAGG - Intergenic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1046136903 8:110039002-110039024 GTGAACCAACAGTAGAAACAGGG - Intergenic
1046638195 8:116696163-116696185 CTGAATCCAGAGATGGGACAGGG + Intronic
1046664089 8:116980072-116980094 CTCAAGCCTCAGAAGGAGCAGGG - Intronic
1048843075 8:138581881-138581903 TTGATCCCACAGAAGGAATCAGG - Intergenic
1050639503 9:7652278-7652300 CTGAACCCTCCTAAGGAAAAGGG + Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052530335 9:29674931-29674953 CTGAACCGCCAGAAGAAGCAAGG + Intergenic
1052852101 9:33384761-33384783 CTGCGCCCTCAGTAGGAACAGGG - Intronic
1052854954 9:33401405-33401427 CTTAACCCAGCCAAGGAACAGGG + Intronic
1053349710 9:37405158-37405180 GTGAACCTTCAGAAGGAAAAGGG - Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053680205 9:40481312-40481334 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1053682974 9:40497734-40497756 CTTAACCCAGCCAAGGAACAGGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053930196 9:43109622-43109644 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054280740 9:63127194-63127216 CTTAACCCAGCCAAGGAACAGGG - Intergenic
1054283507 9:63143623-63143645 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
1054293285 9:63316822-63316844 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054296074 9:63333234-63333256 CTTAACCCAGCCAAGGAACAGGG + Intergenic
1054391313 9:64621315-64621337 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054394090 9:64637729-64637751 CTTAACCCAGCCAAGGAACAGGG + Intergenic
1054428740 9:65142942-65142964 CTTAACCCAGCCAAGGAACAGGG + Intergenic
1054501640 9:65878601-65878623 CTTAACCCAGCCAAGGAACAGGG - Intronic
1054504416 9:65895012-65895034 CTGCGCCCTCAGTAGGAACAAGG + Exonic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055358449 9:75462330-75462352 CTGAATTCAGAGAAGGCACAGGG + Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1059995479 9:119904753-119904775 TTCAACCCAAAGAAGGATCAGGG + Intergenic
1061866812 9:133496466-133496488 CCTCACCCACAGACGGAACATGG - Intergenic
1186233857 X:7485726-7485748 CTGAAGCCACTGAAGAAACAGGG - Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1190567915 X:51749977-51749999 CTAAACCCACAGAAGCTACTTGG - Intergenic
1191780885 X:64863926-64863948 TTGACCCAAGAGAAGGAACATGG + Intergenic
1192510025 X:71716113-71716135 CTGAGCCCCCAGAAGCGACAGGG + Intronic
1192516672 X:71765440-71765462 CTGAGCCCCCAGAAGCGACAGGG - Intronic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1196482708 X:116168429-116168451 TTGAACACCCACAAGGAACAGGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199448882 X:147957688-147957710 CTGAACTAACACATGGAACATGG - Intergenic