ID: 1058135026

View in Genome Browser
Species Human (GRCh38)
Location 9:101297556-101297578
Sequence CTTTCTTATAATGAGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058135026_1058135028 -6 Left 1058135026 9:101297556-101297578 CCAACCTTCTCATTATAAGAAAG 0: 1
1: 0
2: 0
3: 19
4: 250
Right 1058135028 9:101297573-101297595 AGAAAGCTGCCTGTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058135026 Original CRISPR CTTTCTTATAATGAGAAGGT TGG (reversed) Intronic
901735245 1:11308250-11308272 CATTCTTCTCATCAGAAGGTGGG + Intergenic
905489101 1:38329592-38329614 CTTTATCAAAATGAGCAGGTTGG - Intergenic
910059313 1:83069408-83069430 CTTTCTTATAATCAAATGGTGGG - Intergenic
910188690 1:84573395-84573417 CTTTCTTTTAATAAGATGTTAGG + Intronic
912521182 1:110245825-110245847 CTTTCTGACATTGAGAGGGTGGG + Intronic
914786717 1:150839804-150839826 CTTGCTTTGCATGAGAAGGTTGG - Intronic
918555000 1:185788314-185788336 CTTTGTAAGAAGGAGAAGGTTGG - Intronic
922091810 1:222402718-222402740 CATTTGTATAATGAGAAGATTGG + Intergenic
923076772 1:230616550-230616572 CTTGCCTATGATGAGGAGGTGGG - Intergenic
924177590 1:241408509-241408531 TTTACTTATACTAAGAAGGTAGG - Intergenic
1065142099 10:22727929-22727951 CCATCTTATTATGAGATGGTGGG - Intergenic
1066786521 10:39010318-39010340 CTTTCTTTTAATCAGCAGGTTGG - Intergenic
1066827198 10:39610319-39610341 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1066918858 10:41453500-41453522 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1069174162 10:65269555-65269577 CTTTATTATAGTATGAAGGTAGG - Intergenic
1069610075 10:69767059-69767081 CTTTCATCAAATGACAAGGTGGG - Intergenic
1069665252 10:70150936-70150958 CTTTATTCTAATGTGAGGGTAGG - Exonic
1070833037 10:79431987-79432009 CTTTCTTGGAGTGAGAAGGGAGG - Intronic
1072674419 10:97454735-97454757 CTTTCTCGAAAGGAGAAGGTGGG - Exonic
1073710021 10:106025913-106025935 TTTTCTGATAAGGAGAAGGAAGG - Intergenic
1074542346 10:114375326-114375348 CTTTCTTGTAATGAGCAGATAGG - Intronic
1075345651 10:121680278-121680300 GTTTTTTATATTGAGATGGTGGG - Intergenic
1077790731 11:5437161-5437183 CTTCCTTATAATGATGAAGTTGG + Intronic
1077790858 11:5438304-5438326 CTTCCTTATAATGAAGAAGTTGG + Intronic
1078648244 11:13162776-13162798 CTTTCTTATAATGCAGAGGCTGG - Intergenic
1078791907 11:14551962-14551984 ATTTCTTATAATAAGAATGTTGG + Intronic
1079498757 11:21077055-21077077 CATACTTAAAATGGGAAGGTGGG - Intronic
1080738013 11:35036403-35036425 CTTCTATAAAATGAGAAGGTTGG - Intergenic
1084854387 11:71972871-71972893 GTTTCTCTTAATGTGAAGGTTGG - Intronic
1085712014 11:78837849-78837871 CTTTCTTATAATTAGACATTTGG + Intronic
1085723838 11:78936806-78936828 GTGTGTTAGAATGAGAAGGTGGG + Intronic
1085982584 11:81743316-81743338 CTTTTTAAAAATGAGAAGATTGG + Intergenic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1086830811 11:91560899-91560921 CTTTCTTTTAATGAGTAGTATGG - Intergenic
1087083716 11:94196466-94196488 CTATGTAATAATGAGTAGGTTGG + Intergenic
1087345900 11:96970769-96970791 CTTTCTTATAAGGACTAAGTAGG - Intergenic
1087689663 11:101305442-101305464 TTTACTTATAATGAGCAAGTGGG + Intergenic
1087924071 11:103899268-103899290 ATTTCATATAATGATAAGGGCGG - Intergenic
1089716420 11:120364339-120364361 ATTTCTTATACTGTGCAGGTGGG + Intronic
1092109106 12:5946170-5946192 CTCTCCTATATTGATAAGGTAGG + Intronic
1092894033 12:12996041-12996063 TTTTCTTGTAATGAGAAAGCAGG - Intronic
1094066350 12:26364657-26364679 CCAGATTATAATGAGAAGGTTGG - Intronic
1094410442 12:30162749-30162771 CTTACTTATAATGATAATGGTGG + Intergenic
1095064270 12:37747944-37747966 CTTTCTTTGATTGAGAAGTTTGG + Intergenic
1095670737 12:44857263-44857285 CTGTCTTTTAATGAGAATGTAGG - Intronic
1097875874 12:64642702-64642724 CTTTGTAATAGTGAGAAGTTTGG + Intronic
1098618286 12:72557375-72557397 CTTTCCTATCATAAGTAGGTAGG - Intronic
1098706619 12:73699228-73699250 TTTTCTTATAAAGAGAAAATAGG - Intergenic
1099517813 12:83620044-83620066 CTTTCTTATACTCTGAAGCTAGG + Intergenic
1100303375 12:93328052-93328074 CTTTCTGAAAGAGAGAAGGTAGG + Intergenic
1102560205 12:113756571-113756593 CTTGCTTTTAATCAGAAGGCAGG - Intergenic
1103422374 12:120797727-120797749 CTATCCTATAATGAAGAGGTAGG + Intronic
1105765117 13:23551722-23551744 CTTTCATACAATGAGATGCTTGG + Intergenic
1110870639 13:80448989-80449011 CTTTCTTATAGTGTAAAGGTGGG - Intergenic
1111735216 13:92129364-92129386 CTTTTCTCTAATGAGAAGATAGG - Intronic
1111860265 13:93695875-93695897 TGTTCTTATAGTTAGAAGGTAGG + Intronic
1112089821 13:96070972-96070994 GTCTCTTAGAATGAGAAGCTAGG - Intergenic
1112469919 13:99678745-99678767 CTTTTATATAATTAAAAGGTAGG + Intronic
1113303745 13:109053456-109053478 CTTTCTTATAAGGATAAGCTTGG - Intronic
1114367198 14:22041853-22041875 ATTTATTTTAATGAGAAGGGAGG - Intergenic
1115965783 14:38885859-38885881 CTTTCAGATAATGAGATGTTTGG - Intergenic
1117317107 14:54582285-54582307 CTCTCTCTCAATGAGAAGGTAGG - Intronic
1117657710 14:57973522-57973544 TTTTCTTATAAGGAGCAGGAAGG + Intronic
1119317630 14:73708760-73708782 TTTTCTTATTATAAGAAGGCAGG + Intergenic
1120243362 14:81976175-81976197 ATTTTTTTTAATGAGAAGGGTGG - Intergenic
1125436397 15:39649816-39649838 CTTAATTAGAATGAAAAGGTTGG - Intronic
1125611235 15:40972249-40972271 ATTTCTTATAATGAGCAAGCTGG + Intergenic
1130685458 15:86033138-86033160 CTTTCTAATTATTAGAATGTTGG - Intergenic
1130745065 15:86644157-86644179 CTTTATTATATTGTGAAAGTAGG + Intronic
1131435774 15:92420325-92420347 CTTTCTCATAATGAAACTGTGGG - Intronic
1131826755 15:96327900-96327922 ATTTATTATAATGAGAAGAATGG - Intronic
1133786914 16:8981129-8981151 CTTTAATATAATGTGAAGGCTGG - Intergenic
1134912947 16:18044915-18044937 CCTTTTAAAAATGAGAAGGTGGG - Intergenic
1136488817 16:30591376-30591398 CTTTAATAAAATGAGATGGTGGG - Intergenic
1136661019 16:31762933-31762955 ATTTATTAAAAAGAGAAGGTAGG + Intronic
1136915037 16:34181108-34181130 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1137073204 16:35927131-35927153 CTTTCTTTTATTCAGTAGGTTGG - Intergenic
1137488548 16:48911840-48911862 CTTCCTTATAATGAGGAGTTGGG + Intergenic
1137591903 16:49698819-49698841 CTTTCTTCTCTTCAGAAGGTTGG - Intronic
1137634065 16:49970208-49970230 CTTTCTTTTAATGAAGTGGTAGG + Intergenic
1139024814 16:62803101-62803123 CTTTGGTATAAGGATAAGGTTGG + Intergenic
1142818094 17:2443801-2443823 ATTTCTTATAATGATAAGAAAGG + Intronic
1145297475 17:21602565-21602587 CTGCATTATAATGAGAAGGGTGG + Intergenic
1145366468 17:22270300-22270322 CTGCCTTATAATGAGAAGGGTGG - Intergenic
1147048646 17:37773893-37773915 TTTTCTTTTACTGAGAAGGCAGG + Intergenic
1148207713 17:45789999-45790021 CTTTCTTAGACTGAGGAAGTTGG - Intronic
1148293849 17:46482148-46482170 ATTTATTTTAATGAGCAGGTAGG + Intergenic
1148316032 17:46699851-46699873 ATTTATTTTAATGAGCAGGTAGG + Intronic
1150538414 17:66070656-66070678 CCTTCTTATATTAAGAAGATTGG - Intronic
1150933044 17:69606030-69606052 CTTTCTTATATTCTGAGGGTGGG + Intergenic
1151082904 17:71348965-71348987 CTTACTTTTTATGAGAAAGTTGG - Intergenic
1154086207 18:11308005-11308027 CTTTCTTCTAATGAGCAGTGAGG - Intergenic
1156014398 18:32531948-32531970 GGTTCTTATAATTAGAAGATGGG + Intergenic
1158861391 18:61595453-61595475 CTTGCTCAGAATGAGAACGTAGG - Intergenic
1159400270 18:67923322-67923344 CTTTCTTCTAATGACAAGGGGGG + Intergenic
1160011543 18:75110186-75110208 CTTTCTTGTAAAGAGTAGGATGG + Intergenic
1160527302 18:79545279-79545301 GTTTCTGTTAATGAGAAGGAAGG + Intergenic
1162713334 19:12612338-12612360 CTTTCAGAAAATGAGAATGTTGG - Intronic
1164082651 19:21874069-21874091 CATTCCTACACTGAGAAGGTAGG - Intergenic
1164190625 19:22914120-22914142 CATTCCTACACTGAGAAGGTAGG - Intergenic
1164328432 19:24225801-24225823 CTTTATTTTATTGAGCAGGTTGG - Intergenic
1164339879 19:24381529-24381551 CTTTCTTTTACTGAGCAGTTTGG + Intergenic
1164352542 19:27369549-27369571 CATTCTTTTATTGAGCAGGTTGG - Intergenic
1164354639 19:27407933-27407955 CTTTCTTTTATTGAGCAGTTGGG - Intergenic
1164354678 19:27408783-27408805 CTTTCTTTTATTGAGCAGTTTGG - Intergenic
1167649650 19:50722386-50722408 CCTGCTTATGATGGGAAGGTGGG + Intergenic
925957092 2:8977544-8977566 CTTCCTTAAACTGAGAAAGTTGG - Intronic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
927323915 2:21781045-21781067 CATTTTTATAATCAGAAGGTGGG + Intergenic
928500960 2:31894805-31894827 CTTTCTTTTAATGAGAAATGGGG + Intronic
929050125 2:37829418-37829440 CTGGCTTCTAATGAGAAGGGAGG + Intergenic
929265823 2:39918256-39918278 CTATCTTAAATTGAGAAGGAGGG - Intergenic
930212080 2:48651472-48651494 CTTTGTAATAATGAAAAGTTTGG + Intronic
933741303 2:85536477-85536499 CTCCATGATAATGAGAAGGTGGG - Intergenic
935887497 2:107637975-107637997 CTATCTCATAATGAGAATTTGGG + Intergenic
937050568 2:118884940-118884962 CTTTTGTAAAATGAGAGGGTAGG + Intergenic
939334229 2:140804185-140804207 CTGTCTTATTATAACAAGGTGGG - Intronic
939542115 2:143507218-143507240 CTTTTGGATAAAGAGAAGGTAGG - Intronic
939785252 2:146501923-146501945 ATTTTTTTTAATGAGAAGGAAGG + Intergenic
941019338 2:160391214-160391236 CCTTATTAAAATGAGAAGTTTGG + Intronic
941257445 2:163250993-163251015 TCTTCTTATAATGGGAAGATTGG - Intergenic
942142544 2:172992350-172992372 CATTTTTTTAATGTGAAGGTTGG + Intronic
942219960 2:173759448-173759470 CTTGCTTATAAAGTGGAGGTTGG + Intergenic
942711573 2:178842291-178842313 CATTCATATATTTAGAAGGTGGG - Intronic
945445909 2:209938494-209938516 CTTTCTTTTAAATAGAATGTCGG - Intronic
946273765 2:218615400-218615422 GTTCCTAATAATGAGAGGGTGGG + Intronic
946859741 2:223989573-223989595 CTATCTTATCATGATAAGCTGGG + Intronic
947299846 2:228676975-228676997 ATTTCAAATAATGAGAAGTTTGG + Intergenic
947889177 2:233601708-233601730 ATTTCTTCTAGTGAGAAGATTGG + Intergenic
1171069873 20:22058131-22058153 CTTTCTTAGACTGAGAAGTAAGG - Intergenic
1172205016 20:33157112-33157134 CTTTCTTTCAATAAGAATGTTGG + Intergenic
1172420436 20:34812493-34812515 GTTTCTTATACTAAGAAGTTAGG - Intronic
1172456466 20:35078350-35078372 CTATGTTATAATAAGAAGGAGGG + Intronic
1173358694 20:42320036-42320058 GTTTCTTCCAATGAGAAGATGGG + Intronic
1175752138 20:61506162-61506184 CTTTCTCAAAATGACAAGTTAGG + Intronic
1176320345 21:5311923-5311945 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1176321858 21:5334644-5334666 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1176479515 21:7266428-7266450 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1176895578 21:14374801-14374823 GCTTCTTATAATGAAAAAGTAGG + Intronic
1178453993 21:32729684-32729706 CTTTCTTATAGTGGGAAGCATGG + Intergenic
1180521318 22:16209031-16209053 TTGTCTTATTATGTGAAGGTGGG - Intergenic
1182188990 22:28439745-28439767 CATTCTTACCATGACAAGGTTGG + Intronic
1183578452 22:38707063-38707085 CTTTCTTAAGATGAGGTGGTTGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949506549 3:4733662-4733684 CTATCATATAATGAGTAGCTGGG - Intronic
951441961 3:22733689-22733711 CTTTCTTATAATGCTAAAGGAGG + Intergenic
951754210 3:26071835-26071857 GTTTCTTCTAAAGAGAGGGTAGG + Intergenic
952442422 3:33345453-33345475 CTTTCTTATAATGTCCTGGTAGG - Intronic
953786452 3:45915207-45915229 CTTTCTTCCAATGAGAAAGATGG + Intronic
959983759 3:112549404-112549426 CTTTCCTATAATGAGTAAATTGG + Intronic
960457875 3:117895729-117895751 CATTCTAATAATGACAAGATAGG - Intergenic
960799082 3:121519903-121519925 CTTACTTATAAGCAGATGGTTGG - Exonic
962120777 3:132557697-132557719 CTTTCTAATAATCAGATGGCAGG - Intergenic
963625254 3:147663762-147663784 CTTTCTTATAATCTGACAGTGGG + Intergenic
965017671 3:163179267-163179289 ATTTTTTATAATCAGAAAGTAGG - Intergenic
965950634 3:174304004-174304026 CTTTTTAATAATGAGAAAATTGG + Intergenic
966102456 3:176288173-176288195 CTTTGTTAAAATTAGAAGCTGGG + Intergenic
966492540 3:180544150-180544172 CTTGCTAAAAATGTGAAGGTAGG + Intergenic
967295464 3:187959976-187959998 CTTTGTTTAAATGAGAAGATTGG - Intergenic
967511739 3:190321278-190321300 CTATCTTGGAAAGAGAAGGTTGG - Intronic
970555916 4:17232315-17232337 CTTTCTTATCATAACAAGGATGG + Intergenic
970948304 4:21721655-21721677 GTGTTTGATAATGAGAAGGTGGG - Intronic
972028152 4:34413278-34413300 CTATCTATTAAGGAGAAGGTTGG - Intergenic
973836885 4:54818755-54818777 CTTTCTTTTCATGAGAAAATTGG - Intergenic
974800897 4:66816490-66816512 TTTTCTTATAATGACAGGGATGG + Intergenic
975693201 4:76985799-76985821 TTATCTGAAAATGAGAAGGTTGG + Intronic
977674892 4:99736067-99736089 CATTCATAAAATGAGAAGGTTGG + Intergenic
978575144 4:110182316-110182338 CTTTCTTAGACTGAGGAGGAGGG - Intronic
979149428 4:117290909-117290931 CTATGTTATAATGAAAAGGAAGG - Intergenic
979837477 4:125389637-125389659 CTTTCATAGAATGAGTTGGTAGG + Intronic
980508160 4:133750510-133750532 CTTTCTAATAATTTGAACGTAGG + Intergenic
980540813 4:134191796-134191818 TTTTCTTAAGATGAGAAGTTAGG - Intergenic
980822269 4:138033302-138033324 TTTACTTATATTGAAAAGGTAGG - Intergenic
981964844 4:150588001-150588023 TTTTCTTATGATGGGATGGTGGG - Intronic
981988908 4:150892192-150892214 CTTTTGTTTAATGAGAAAGTGGG - Intronic
983126990 4:163965534-163965556 CTCTCTTACAATGGGATGGTAGG + Intronic
986464677 5:8008991-8009013 CTTCCTTATAAGAAGAAGGCAGG - Intergenic
986782209 5:11076845-11076867 CATTCTTTTAATGAGAGGTTGGG - Intronic
989854484 5:46264535-46264557 CTTTCTTTTGATGAGCAGTTTGG - Intergenic
989946311 5:50234312-50234334 CTTTCTTTTATTGAGCAGTTTGG - Intergenic
990350822 5:54914167-54914189 CTTTTTGATATTGAAAAGGTTGG + Intergenic
991282110 5:64926786-64926808 CTTTCCTACTATGAGCAGGTGGG + Intronic
991367806 5:65887176-65887198 CTTCCTTAGAAGGGGAAGGTTGG + Intergenic
992044707 5:72874705-72874727 CTTTCTTATAATGAGATTTTAGG + Intronic
995489996 5:112680751-112680773 CTTTCTTGTAATGAAAAACTAGG + Intergenic
995527267 5:113059965-113059987 TTTTCTTCTAATGAGCAGGCTGG - Intronic
996913029 5:128677774-128677796 GTTTGTTATAAAGAGGAGGTAGG + Intronic
998951609 5:147398148-147398170 CTGTCTTGTATTGAGCAGGTGGG + Intronic
999611151 5:153371047-153371069 CTATCTGAAAATGATAAGGTTGG + Intergenic
999911600 5:156207564-156207586 CTTTCTTAAAATTAGTAGTTTGG + Intronic
1004093846 6:12532964-12532986 CTTTCTTATAATCATGATGTCGG + Intergenic
1004168637 6:13278160-13278182 CTTTATTAAAATGAGATGCTTGG + Intronic
1005771276 6:29075034-29075056 CTTTATTCTAATGTGAGGGTAGG - Intronic
1009049535 6:58260841-58260863 GTTTCTAATAATCAGGAGGTAGG - Intergenic
1009225083 6:61014075-61014097 GTTTCTAATAATCAGTAGGTAGG - Intergenic
1009339741 6:62539352-62539374 TTATTTTATAATGAGAAGTTAGG + Intergenic
1009842111 6:69090886-69090908 CTTTCTAATAGTGAGAATATGGG - Intronic
1010360179 6:74984485-74984507 CTTTCTTATAAGGAAAATTTAGG + Intergenic
1011214088 6:84986734-84986756 CTTTCTTATTAGAAGAAGTTAGG + Intergenic
1013208135 6:107962977-107962999 CTTTCTTTTTATGAGTATGTTGG + Intergenic
1017091312 6:150761884-150761906 CTTTCTCATAGTGAGGAGATGGG - Intronic
1020654052 7:10908903-10908925 CTTTCTCATATTGAGAAAGTCGG - Intergenic
1021583898 7:22187555-22187577 ATCTCTTGGAATGAGAAGGTGGG - Intronic
1022299173 7:29086724-29086746 CTTTGTGATAATAAGAAGTTTGG + Intronic
1023568179 7:41544487-41544509 GTTTCTTAAAATGAGAAAATGGG - Intergenic
1023616646 7:42026518-42026540 ATTTGTTTAAATGAGAAGGTAGG + Intronic
1025313781 7:57990003-57990025 CTTTCTTTTGATGAGTAGTTTGG - Intergenic
1025313834 7:57991022-57991044 CTTTCTTTTAATGAGTAGTTTGG - Intergenic
1025523709 7:61776770-61776792 ATTTCTTTTAATGAGCAGTTTGG - Intergenic
1027552357 7:79615048-79615070 CTTACTTATACTGAGCATGTGGG - Intergenic
1027887590 7:83929346-83929368 ATTTATTATAAGTAGAAGGTAGG - Intergenic
1028995812 7:97098720-97098742 CCCTCTTAAAATGAGAATGTTGG - Intergenic
1031518027 7:122725552-122725574 ATTTCTCAAAATGAGAGGGTGGG - Intronic
1032526844 7:132584214-132584236 TTTTCTTTTAATTAAAAGGTGGG - Intronic
1033965689 7:146972688-146972710 CTTAGTTATAAAGAGAAGTTTGG + Intronic
1036475594 8:9090130-9090152 TTTGCTTACAAGGAGAAGGTGGG - Intronic
1036673270 8:10807275-10807297 TTACCTTATAATAAGAAGGTTGG + Intronic
1037597334 8:20365275-20365297 CATTCCTAAAATGAAAAGGTGGG - Intergenic
1037875200 8:22542286-22542308 CATTCTTCTAATGAGAAGTATGG - Intergenic
1039432889 8:37539459-37539481 CTTGCAGATAATGAGAAGTTGGG - Intergenic
1040118457 8:43652496-43652518 TTTTGTTTTACTGAGAAGGTTGG + Intergenic
1040128596 8:43767540-43767562 CTTTCTTTTATTCAGCAGGTTGG + Intergenic
1040130402 8:43789276-43789298 CTTTCTTTTGATTAGGAGGTTGG + Intergenic
1040130790 8:43793981-43794003 CTTTCTTTTATTCAGGAGGTTGG + Intergenic
1040274938 8:46006258-46006280 GTTTCTTTTAATCAGCAGGTTGG + Intergenic
1040297069 8:46157340-46157362 CTTTCTTTTGTTCAGAAGGTTGG - Intergenic
1040326984 8:46351717-46351739 CTTTCTTTTGATGAGCAGGTAGG - Intergenic
1040344861 8:46482075-46482097 CTTTCTTACAATAAGCAGGTTGG - Intergenic
1040345819 8:46492155-46492177 CTTTTTTATATTTAGCAGGTTGG - Intergenic
1041370791 8:57158527-57158549 CTTCCTTAAATTGAGAAAGTTGG + Intergenic
1042112743 8:65398107-65398129 CTTTCACATACTGAGAAAGTAGG - Intergenic
1042333083 8:67603012-67603034 CTTGCTTATAATGAGACCATTGG - Intronic
1046614453 8:116460793-116460815 CGTTTTAATAATGAGCAGGTGGG + Intergenic
1046716000 8:117567994-117568016 CTTTCTTATAATGATCAGTGGGG + Intergenic
1046769340 8:118102852-118102874 CTTTCTTTGAAAGACAAGGTCGG + Intronic
1047851713 8:128864444-128864466 CTTGCTTATAATGAAAAAGCTGG - Intergenic
1047930593 8:129724885-129724907 TTTTCTTCTCATGAGAAGCTGGG - Intergenic
1049459767 8:142720774-142720796 CTTTCTTATAATAAGAACATTGG - Intergenic
1053716759 9:40904604-40904626 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1054756779 9:68966818-68966840 CTTTGTTATAATGTAAATGTTGG + Intronic
1056714392 9:89016185-89016207 CTTTCTTATATTGATAATTTGGG - Intronic
1057820476 9:98326472-98326494 CTTTTTTATAATTAGGTGGTGGG + Intronic
1058135026 9:101297556-101297578 CTTTCTTATAATGAGAAGGTTGG - Intronic
1059794868 9:117683176-117683198 CTTTCTCAAAATGAGTTGGTTGG + Intergenic
1060958393 9:127661243-127661265 CTGTCTTATTCTGAGAGGGTGGG + Intronic
1061681229 9:132243373-132243395 CTTCCTAATCTTGAGAAGGTAGG - Exonic
1203420123 Un_KI270376v1:1044-1066 CTTTCTTTGATTGAGAAGTTTGG - Intergenic
1203378915 Un_KI270435v1:9772-9794 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1203383383 Un_KI270435v1:85995-86017 CTTTCTTTGATTGAGAAGTTTGG - Intergenic
1203358222 Un_KI270442v1:183323-183345 CTTTCTTTTGATGAGCAGTTTGG + Intergenic
1203358459 Un_KI270442v1:187888-187910 CTTTCTTTGATTGAGAAGTTTGG - Intergenic
1203414141 Un_KI270589v1:34039-34061 CTTTCTTTTATTGAGCAGTTTGG - Intergenic
1203684139 Un_KI270757v1:25839-25861 CTTTCTTTTATTGAGCAGTTTGG + Intergenic
1187250779 X:17596270-17596292 CTTCCTTAGAATGGGAAGGATGG + Intronic
1187404481 X:18990630-18990652 CTTTCATTTTATAAGAAGGTTGG - Exonic
1188416779 X:29944939-29944961 TTTTTTTTTAATGGGAAGGTGGG - Intronic
1189012286 X:37058532-37058554 CTTTATTATAAAGACATGGTTGG + Intergenic
1189036424 X:37497736-37497758 CTTTATTATAAAGACATGGTTGG - Intronic
1189554741 X:42130327-42130349 TTTTCTGACAATGGGAAGGTGGG + Intergenic
1190124411 X:47690739-47690761 CTTACTTATAAGGGGATGGTGGG - Intergenic
1191569270 X:62588158-62588180 CTTTCTTTTAATGAGCAGTTTGG + Intergenic
1191662325 X:63664575-63664597 CTTTCATAAAATCAGGAGGTAGG - Intronic
1192214187 X:69146828-69146850 CTATATTACAATGAGAAGATTGG + Intergenic
1193674885 X:84438082-84438104 CTTTCTTGTATTGCTAAGGTGGG + Intronic
1195923052 X:110002135-110002157 CTTTCTAGTAATGAGCAGCTTGG - Intergenic
1196710448 X:118756760-118756782 CTGGCTGATAATGGGAAGGTTGG + Intronic
1197536597 X:127696404-127696426 CTTCCTTATCATGCGAAGGAGGG - Intergenic
1198820528 X:140643258-140643280 CTCTTGTAAAATGAGAAGGTTGG - Intergenic
1198920874 X:141725032-141725054 CCTTCTTAAAATGAGAGGATTGG + Intergenic
1200945634 Y:8833162-8833184 CCTTCTTAAAATGAGAGGATTGG + Intergenic