ID: 1058137704

View in Genome Browser
Species Human (GRCh38)
Location 9:101325734-101325756
Sequence CCCATGAAAAGATGTGGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058137704_1058137707 6 Left 1058137704 9:101325734-101325756 CCGAGTCCACATCTTTTCATGGG No data
Right 1058137707 9:101325763-101325785 GTGTAATAAACCTACTTATCTGG No data
1058137704_1058137708 13 Left 1058137704 9:101325734-101325756 CCGAGTCCACATCTTTTCATGGG No data
Right 1058137708 9:101325770-101325792 AAACCTACTTATCTGGTTTAAGG No data
1058137704_1058137711 24 Left 1058137704 9:101325734-101325756 CCGAGTCCACATCTTTTCATGGG No data
Right 1058137711 9:101325781-101325803 TCTGGTTTAAGGGATGCTGCTGG No data
1058137704_1058137709 14 Left 1058137704 9:101325734-101325756 CCGAGTCCACATCTTTTCATGGG No data
Right 1058137709 9:101325771-101325793 AACCTACTTATCTGGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058137704 Original CRISPR CCCATGAAAAGATGTGGACT CGG (reversed) Intergenic
No off target data available for this crispr