ID: 1058137711

View in Genome Browser
Species Human (GRCh38)
Location 9:101325781-101325803
Sequence TCTGGTTTAAGGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058137706_1058137711 18 Left 1058137706 9:101325740-101325762 CCACATCTTTTCATGGGTTTTCA No data
Right 1058137711 9:101325781-101325803 TCTGGTTTAAGGGATGCTGCTGG No data
1058137704_1058137711 24 Left 1058137704 9:101325734-101325756 CCGAGTCCACATCTTTTCATGGG No data
Right 1058137711 9:101325781-101325803 TCTGGTTTAAGGGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058137711 Original CRISPR TCTGGTTTAAGGGATGCTGC TGG Intergenic
No off target data available for this crispr