ID: 1058140824

View in Genome Browser
Species Human (GRCh38)
Location 9:101355354-101355376
Sequence CTGTATCAAAAGAGGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058140824_1058140832 18 Left 1058140824 9:101355354-101355376 CCAAGCTTCCTCTTTTGATACAG No data
Right 1058140832 9:101355395-101355417 TGGCAGTCTGTGCCTATGATAGG No data
1058140824_1058140826 -2 Left 1058140824 9:101355354-101355376 CCAAGCTTCCTCTTTTGATACAG No data
Right 1058140826 9:101355375-101355397 AGATATGTTGCCCCCAGCCTTGG No data
1058140824_1058140833 22 Left 1058140824 9:101355354-101355376 CCAAGCTTCCTCTTTTGATACAG No data
Right 1058140833 9:101355399-101355421 AGTCTGTGCCTATGATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058140824 Original CRISPR CTGTATCAAAAGAGGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr