ID: 1058140824 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:101355354-101355376 |
| Sequence | CTGTATCAAAAGAGGAAGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058140824_1058140832 | 18 | Left | 1058140824 | 9:101355354-101355376 | CCAAGCTTCCTCTTTTGATACAG | No data | ||
| Right | 1058140832 | 9:101355395-101355417 | TGGCAGTCTGTGCCTATGATAGG | No data | ||||
| 1058140824_1058140826 | -2 | Left | 1058140824 | 9:101355354-101355376 | CCAAGCTTCCTCTTTTGATACAG | No data | ||
| Right | 1058140826 | 9:101355375-101355397 | AGATATGTTGCCCCCAGCCTTGG | No data | ||||
| 1058140824_1058140833 | 22 | Left | 1058140824 | 9:101355354-101355376 | CCAAGCTTCCTCTTTTGATACAG | No data | ||
| Right | 1058140833 | 9:101355399-101355421 | AGTCTGTGCCTATGATAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058140824 | Original CRISPR | CTGTATCAAAAGAGGAAGCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||