ID: 1058143189

View in Genome Browser
Species Human (GRCh38)
Location 9:101380280-101380302
Sequence AAGGATATACATGCTTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058143189_1058143202 22 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143189_1058143203 23 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143203 9:101380326-101380348 GTCTGGGGAGTAACAGTGAGGGG No data
1058143189_1058143197 7 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143197 9:101380310-101380332 GGTATATCAACCCTGGGTCTGGG No data
1058143189_1058143201 21 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143201 9:101380324-101380346 GGGTCTGGGGAGTAACAGTGAGG No data
1058143189_1058143194 1 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143194 9:101380304-101380326 CCCTATGGTATATCAACCCTGGG No data
1058143189_1058143196 6 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143196 9:101380309-101380331 TGGTATATCAACCCTGGGTCTGG No data
1058143189_1058143198 8 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143198 9:101380311-101380333 GTATATCAACCCTGGGTCTGGGG No data
1058143189_1058143192 0 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143192 9:101380303-101380325 TCCCTATGGTATATCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058143189 Original CRISPR AAGGATATACATGCTTCAGC AGG (reversed) Intronic
905945578 1:41898765-41898787 AAGCCTCTACTTGCTTCAGCTGG - Intronic
908577942 1:65481148-65481170 AAGGAGATACATGTGACAGCAGG - Intronic
908762139 1:67522302-67522324 AATGATACACATGCTTCCGCAGG - Intergenic
908942531 1:69453163-69453185 AAGAATATATGTGCTTCAGAAGG + Intergenic
910719761 1:90273230-90273252 AAGGATATAAACCCTTCAGATGG + Intergenic
910992554 1:93071483-93071505 AAGAATATTCACGATTCAGCTGG + Intergenic
915904571 1:159868407-159868429 AAGGATATTCAAGCATCAGAGGG + Intronic
916071094 1:161170378-161170400 AAGGACATTCATGCGTCAGAAGG - Intronic
916742008 1:167654353-167654375 AAGGGTACACGTGCTTCAGAGGG + Intronic
916801695 1:168222052-168222074 AAGGATAAACCTGCTTCATGTGG + Intergenic
917539073 1:175896085-175896107 AAGGACATACATGATATAGCAGG - Intergenic
923058958 1:230452636-230452658 AAGGGTACACATGCTTCAGAAGG + Intergenic
923135960 1:231119101-231119123 AAGGCTATAAATGCAGCAGCTGG + Intergenic
923279041 1:232424349-232424371 AAGGACATACATCTTTCACCTGG + Intronic
1067712242 10:48658582-48658604 CAGGAAATACATGCTTCTGTGGG + Intergenic
1079484954 11:20926059-20926081 AAGGATAAACATGATTGAGAAGG + Intronic
1080013275 11:27479280-27479302 AAAAATATACATGTATCAGCCGG + Intergenic
1080691042 11:34558351-34558373 AAGGATATGCATATTTCAGTAGG + Intergenic
1080857554 11:36125559-36125581 AAGGGTAAACAGGCCTCAGCTGG + Intronic
1087802160 11:102516231-102516253 AAGGGTATACATGCTTCAGAAGG - Intergenic
1089354587 11:117841355-117841377 AAGGAAATACATTCTATAGCTGG + Intronic
1091609736 12:1995728-1995750 AAGGATACAGATGAGTCAGCTGG - Intronic
1093351725 12:18110996-18111018 AAGGATATGCTTGCTTGAGATGG - Intronic
1097958172 12:65507341-65507363 ATGGACATTCATGCTTCTGCGGG + Intergenic
1098042558 12:66367117-66367139 AAGGATATTTAAGCTTCAGAAGG + Intronic
1105480967 13:20774979-20775001 AAGGATATAAACTGTTCAGCTGG + Intergenic
1105994444 13:25656754-25656776 AAAGATATATTTTCTTCAGCTGG + Intronic
1107100222 13:36582356-36582378 AAGGGTACACATGCTCCAGCAGG - Intergenic
1107796749 13:44060913-44060935 AAGGGTACACATACTTCAGAGGG + Intergenic
1112251931 13:97789550-97789572 AATGTTATACATGCTCCAGAGGG + Intergenic
1117027457 14:51636193-51636215 AAGGGTATGCATGATTCAGATGG + Intronic
1123873918 15:24604970-24604992 AAAGGTATACATGCTTCAGCAGG - Intergenic
1125431208 15:39595626-39595648 AAGCATCTACTTGCTTCAGTTGG + Exonic
1125763268 15:42113392-42113414 AAGGATAGACAGGCTGGAGCAGG + Intergenic
1131909027 15:97176028-97176050 AATGATATAAATGCTACAGTGGG - Intergenic
1132377844 15:101342603-101342625 AAGAATACACTGGCTTCAGCTGG + Intronic
1134486692 16:14664205-14664227 AGGGGCATACATGCTTCAGAAGG + Intronic
1134486867 16:14665587-14665609 AGGGGCATACATGCTTCAGAAGG + Intronic
1137520803 16:49193901-49193923 AAGGGTAAACATTCTCCAGCTGG + Intergenic
1139014386 16:62672263-62672285 AAAGATATGCATGCTTTATCTGG - Intergenic
1140778140 16:78269150-78269172 TTGGATATACATACTTTAGCTGG - Intronic
1141240241 16:82259223-82259245 AGGGAGATACATGATTCATCTGG + Intergenic
1144367005 17:14554238-14554260 AGGCATACACATCCTTCAGCTGG - Intergenic
1145010882 17:19367076-19367098 AAGGGCATACATGCTTCAGAAGG + Intronic
1146272030 17:31490851-31490873 ACAGATAAAGATGCTTCAGCTGG - Intronic
1147547906 17:41417461-41417483 AAGGACATAGATGCTGCAGAAGG + Intergenic
1147753300 17:42750726-42750748 AAGAATATTCCTGATTCAGCCGG - Intergenic
1156309886 18:35912141-35912163 AAGGATGTACAGGTTACAGCAGG - Intergenic
1156553096 18:38039286-38039308 ATGGATATACCTACTTCAGAGGG + Intergenic
1156955224 18:42954525-42954547 AAGGAGGAACATGCTTCAGAAGG - Intronic
1157111356 18:44823434-44823456 AAGCAAATAAATGATTCAGCAGG + Intronic
1158676201 18:59520717-59520739 TTGGATATACATGGTTCAGATGG - Intronic
1160088768 18:75806230-75806252 AAGAAAATAAAGGCTTCAGCAGG + Intergenic
1160482844 18:79258581-79258603 AAGGATACACAGACTTCACCTGG - Intronic
1166398268 19:42458382-42458404 AAGGATATATATGCATTAGCAGG + Intergenic
1168461063 19:56559033-56559055 AAGGATATTCATGATATAGCAGG + Intergenic
1168679594 19:58305008-58305030 AAGGATATACAAGGTTCAGGGGG + Intronic
929854462 2:45624782-45624804 AAGGAGATACTTGCTTTGGCAGG + Intergenic
930372253 2:50516635-50516657 AAGGAGTTACATGGGTCAGCAGG - Intronic
933039862 2:77450739-77450761 AAGGTGATAAGTGCTTCAGCTGG - Intronic
933105337 2:78317396-78317418 AATGATATACATATTTGAGCAGG - Intergenic
933788761 2:85866644-85866666 AAGGAAAGAGATGCTTGAGCTGG - Intronic
936280128 2:111131821-111131843 AAGTGTATATATGCTTCAGAAGG + Intronic
936630214 2:114194007-114194029 AATGATGTCCATGCTTCACCAGG + Intergenic
939254136 2:139720798-139720820 AAATATATACATGCTACAGTGGG - Intergenic
939507120 2:143059128-143059150 CAGGACATAGATGCTACAGCTGG + Intergenic
942211138 2:173671538-173671560 AAGGGTATACATGATTCAGAAGG - Intergenic
942211398 2:173674661-173674683 AAGGGTATACATGATTCAGAAGG + Intergenic
942736275 2:179117567-179117589 AAGGTTAAAGATGCTTCAGATGG - Exonic
1174899427 20:54482963-54482985 ATATATATACATGCATCAGCTGG + Intronic
1178922732 21:36749023-36749045 AAGGAAAAACATGCTTAAGGGGG + Exonic
1179536063 21:42053463-42053485 AAGGTTATACATGCTGCACTCGG - Intergenic
1182737585 22:32541962-32541984 AAGGATGAACATGTTTCAGATGG + Intronic
949447003 3:4145784-4145806 AAGGATAAACATAAATCAGCAGG + Intronic
949480485 3:4489858-4489880 CAGGATATAAATGGTACAGCTGG + Intergenic
952283299 3:31944490-31944512 AAATATATCCATGCTTTAGCAGG - Intronic
953469090 3:43151720-43151742 AAGAATATACATGCTTGGGGAGG - Intergenic
955106461 3:55903427-55903449 AAGGATCTGATTGCTTCAGCTGG + Intronic
955723203 3:61905214-61905236 GAGGACATACATACTTCAGTGGG + Intronic
957707027 3:83802103-83802125 AAGAATATACACAATTCAGCTGG - Intergenic
959942739 3:112096381-112096403 AAGGGTATGCATGCTTCAGAAGG + Intronic
960657414 3:120021208-120021230 AAGAATATTCATGATTCAGCGGG + Intronic
963352068 3:144164178-144164200 AAGGCTATATGTGCTTCTGCTGG + Intergenic
964894700 3:161581600-161581622 AAGGATGAAAATGATTCAGCAGG - Intergenic
965971297 3:174559338-174559360 AAGATTATATATGCTTCAGAAGG + Intronic
971730784 4:30376759-30376781 AAGGATAAACAGGCATCACCGGG + Intergenic
972377521 4:38486494-38486516 AAGAATATTCATTCTTTAGCTGG - Intergenic
972930680 4:44068297-44068319 AAGGATAATCATGATTCAGAAGG + Intergenic
973783079 4:54308372-54308394 CAGGATACACATGCTCCAGAGGG - Intergenic
975498120 4:75056688-75056710 AATGATATAAATTTTTCAGCTGG - Intergenic
975884757 4:78951686-78951708 ATGGCTCTACAAGCTTCAGCAGG - Intergenic
976476311 4:85486961-85486983 AAGGATAAAGCTCCTTCAGCAGG + Intronic
981671003 4:147286885-147286907 AAGAATATCCAAGCTTCACCTGG + Intergenic
982306055 4:153932261-153932283 AAGCATATCCAGGCTCCAGCTGG - Intergenic
984159760 4:176237661-176237683 AAGCAGAGACATGCTGCAGCCGG + Intronic
986511708 5:8514178-8514200 AAGTATAAACATACTTCAGTGGG - Intergenic
987718209 5:21598471-21598493 AAGGATATACATGCCTGAATAGG - Intergenic
992073391 5:73169330-73169352 AAGGGTATGTATGCTTCAGAAGG + Intergenic
992619088 5:78574821-78574843 AAGGCTATTCATGCTAAAGCAGG + Intronic
994133730 5:96261457-96261479 AAGGCTATACATGATGCAGAAGG + Intergenic
1002631929 5:180588031-180588053 AAAGGTACACATGCTTCAGCAGG - Intergenic
1007990008 6:46245309-46245331 CAGGACATACATGCAACAGCTGG + Intronic
1010404838 6:75492930-75492952 AAGGAGACACATGCAACAGCAGG + Intronic
1011990515 6:93509567-93509589 AAAGATATACATGCGGCAACAGG - Intergenic
1012918647 6:105198261-105198283 AAGAATATTCATGAATCAGCCGG + Intergenic
1014402656 6:121010103-121010125 AAGGATACAAATGTTCCAGCTGG - Intergenic
1014601562 6:123419215-123419237 AAGGGTATAGATGTTTCAGAAGG + Intronic
1017712939 6:157186188-157186210 AAGGATCTATACGCCTCAGCAGG - Intronic
1021185376 7:17558034-17558056 AATAGTATACATGCTTCAGGAGG + Intergenic
1022993265 7:35729133-35729155 AAGGAAAGACATGCTACAGAAGG + Intergenic
1023434275 7:40126111-40126133 AGGGAGATACAAGCTTCAGATGG - Exonic
1024456785 7:49617571-49617593 ATGGAAATATATGCTTCTGCAGG + Intergenic
1024857351 7:53796875-53796897 CAGAATGTCCATGCTTCAGCAGG + Intergenic
1028766665 7:94567472-94567494 AAGTATACACATGCTTCATGAGG - Intergenic
1033059365 7:138090784-138090806 AAGGGTACACATGCTCCAGTAGG + Intronic
1033981786 7:147174043-147174065 GAGGACATACATGATTCAGAGGG - Intronic
1034604180 7:152295676-152295698 AAGCAGAAACATGCTTCAGAGGG + Intronic
1037077516 8:14738991-14739013 AAGAATATACATGCATTATCAGG + Intronic
1037428254 8:18781303-18781325 AAGGATATGCATGCATCAGAAGG - Intronic
1038081435 8:24141279-24141301 AAGGAAAGACAAGTTTCAGCAGG - Intergenic
1038354807 8:26817933-26817955 ACAGACATACATCCTTCAGCTGG + Intronic
1038750013 8:30286207-30286229 AAGGTTATAAATGCTGCAGGAGG - Intergenic
1042016215 8:64315954-64315976 AAGAATATGCATGTTTGAGCTGG - Intergenic
1042203269 8:66302742-66302764 AAGGGTGTACATGATTCAGAAGG + Intergenic
1043479228 8:80636360-80636382 AATGATATACATGCTTTAAAAGG - Exonic
1044583754 8:93849723-93849745 CAGGATATGCTTGCTTCATCCGG + Intergenic
1047059078 8:121202811-121202833 AAGGAAATTCATGCCTCATCGGG + Intergenic
1053470269 9:38341344-38341366 AAGGATATTCATGGTGCAGGGGG - Intergenic
1053876229 9:42549310-42549332 AAGAATTTACATGCTTAAACGGG - Intergenic
1054235468 9:62552412-62552434 AAGAATTTACATGCTTAAACGGG + Intergenic
1058143189 9:101380280-101380302 AAGGATATACATGCTTCAGCAGG - Intronic
1058973260 9:110102234-110102256 AAGGATATTCCTGCTTTAGATGG - Intronic
1059789098 9:117620454-117620476 AAGGATATAGGTGCTGCAGCTGG - Intergenic
1059851371 9:118344652-118344674 CAGGATATTAATTCTTCAGCAGG - Intergenic
1187090318 X:16089339-16089361 AAGGATATTTATGCTTCATTAGG + Intergenic
1187538566 X:20167192-20167214 AAGGAGTCACATGCTTCGGCTGG - Intronic
1190831988 X:54066887-54066909 AAGTGTTTACAAGCTTCAGCAGG + Intergenic
1193193768 X:78605463-78605485 TTGGATATACATGCAGCAGCAGG - Intergenic
1193661265 X:84261630-84261652 AATGATATAAAGGCTTTAGCAGG - Intergenic
1193719853 X:84974131-84974153 AAGAGAATACATGCTTCCGCCGG - Intergenic
1193872884 X:86823474-86823496 AATGATCCACATACTTCAGCTGG + Intronic