ID: 1058143191

View in Genome Browser
Species Human (GRCh38)
Location 9:101380299-101380321
Sequence GGTTGATATACCATAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 3, 2: 16, 3: 64, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058143191_1058143202 3 Left 1058143191 9:101380299-101380321 CCTTTCCCTATGGTATATCAACC 0: 1
1: 3
2: 16
3: 64
4: 154
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143191_1058143203 4 Left 1058143191 9:101380299-101380321 CCTTTCCCTATGGTATATCAACC 0: 1
1: 3
2: 16
3: 64
4: 154
Right 1058143203 9:101380326-101380348 GTCTGGGGAGTAACAGTGAGGGG No data
1058143191_1058143201 2 Left 1058143191 9:101380299-101380321 CCTTTCCCTATGGTATATCAACC 0: 1
1: 3
2: 16
3: 64
4: 154
Right 1058143201 9:101380324-101380346 GGGTCTGGGGAGTAACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058143191 Original CRISPR GGTTGATATACCATAGGGAA AGG (reversed) Intronic
901780552 1:11591633-11591655 GGCTTATATACCACAGGGAAAGG - Intergenic
902515448 1:16987263-16987285 TGTTGATCTGCCACAGGGAAGGG + Exonic
903484985 1:23682938-23682960 GGCTCATATACCATAGGGAAAGG + Intergenic
904357679 1:29951592-29951614 GGCTTATATGCCATAGGGAAAGG - Intergenic
904578923 1:31525134-31525156 GGCTTCTGTACCATAGGGAAAGG + Intergenic
904712523 1:32441218-32441240 GGCTTATTTACCATAGGGAAAGG + Intergenic
904924505 1:34036987-34037009 GGCATATGTACCATAGGGAAAGG - Intronic
905529734 1:38668036-38668058 GGTTGATATACCAAAGCAAATGG + Intergenic
909215572 1:72883706-72883728 GGTTGATTTAACATAGGCCAGGG - Intergenic
909443141 1:75720137-75720159 GGGTTGTATACCACAGGGAAAGG - Intergenic
910809040 1:91217623-91217645 GGTGGAAAAACTATAGGGAAAGG + Intergenic
910809449 1:91220908-91220930 GGTAGAAAAACTATAGGGAAAGG + Intergenic
911064378 1:93774611-93774633 GTTTGTTAGACCATAGGGACAGG - Intronic
911172774 1:94786380-94786402 GGTTGATATACCCCAAGGTAAGG - Intergenic
912824084 1:112889459-112889481 GGCTTATACACCATAGGGAAAGG + Intergenic
913334773 1:117699198-117699220 GGATTATATACCACAGGGGAGGG - Intergenic
914221133 1:145682886-145682908 GGCTGATATACCATAGGGAAAGG - Intronic
914389578 1:147207834-147207856 GGATGATATACCACAGGGGAGGG - Intronic
914473705 1:148005759-148005781 GGCTGATATACCATAGGGAAAGG - Intergenic
916742004 1:167654334-167654356 GGATTATATACCATAGGGAAAGG + Intronic
916886067 1:169069542-169069564 AGCTGATAGACAATAGGGAATGG - Intergenic
917154270 1:171979335-171979357 GGTAGATATACCCTAAAGAAAGG + Intronic
917888834 1:179416760-179416782 GGCTTATATACCATAAAGAAAGG - Intronic
917940893 1:179920514-179920536 TGTTGAAATATCATGGGGAAGGG - Intronic
919281637 1:195496519-195496541 GGGGGATATCCCATAGTGAAAGG + Intergenic
919853448 1:201689618-201689640 GGCTTATGTACCATAAGGAAAGG - Intronic
923058955 1:230452617-230452639 GGCTTATATACCATAGGGAAAGG + Intergenic
1063076679 10:2723660-2723682 GGTAGATAAACCATAGGGCCAGG + Intergenic
1064061580 10:12142019-12142041 GGCTAATCTATCATAGGGAAGGG + Intronic
1064720927 10:18227675-18227697 CGCTTATCTACCATAGGGAAAGG + Intronic
1067386616 10:45822608-45822630 GGCTTCTATAGCATAGGGAAAGG + Intergenic
1067791445 10:49291349-49291371 GGCTCATATACCACAGGGGAGGG - Intergenic
1069558073 10:69410870-69410892 GGCTTAGATACCATAGGGAAAGG - Intronic
1070716713 10:78727672-78727694 GGTTGATATACCACAGTTACAGG + Intergenic
1071658868 10:87478230-87478252 GGTTTGTGTACCATATGGAAAGG + Intergenic
1071707627 10:88016428-88016450 GGCTTATATACCATAGGAGAGGG + Intergenic
1071781993 10:88856336-88856358 GGCTTATATATCATAAGGAAAGG - Intergenic
1073085776 10:100887741-100887763 GGCTTATATACCATAGAGAAAGG + Intergenic
1074844466 10:117384979-117385001 GGCTTATATTCCATAGGAAAAGG + Intergenic
1077939991 11:6831000-6831022 GGCTTATATACCATAGGGAAAGG - Intergenic
1078165510 11:8880096-8880118 GGTTGACATACCACAGACAAAGG + Intronic
1078385425 11:10887666-10887688 GGCTTATATACCACAGGGAAAGG - Intergenic
1079049390 11:17139987-17140009 GTTTAATATCCTATAGGGAATGG - Intronic
1079885887 11:25988222-25988244 GGTTTATATGCCATAGGGAGAGG + Intergenic
1081200907 11:40214267-40214289 GGATTATATACCATAGGGGAAGG - Intronic
1083948194 11:65937900-65937922 GGCTTATGTACCATAGGGAAAGG - Intergenic
1085411756 11:76295515-76295537 GGCTTATATACCATAGGGAAAGG - Intergenic
1085872669 11:80368911-80368933 CATTGATATACCAAAGGAAATGG + Intergenic
1086742401 11:90383928-90383950 GGATGATATCACATAGGAAAAGG + Intergenic
1087490864 11:98825384-98825406 GATTTATATGCCATAGGGAAAGG - Intergenic
1087901791 11:103649494-103649516 GGCTTATATACCATAGAGAAAGG + Intergenic
1088107607 11:106224076-106224098 GTTTGATATACAACAGGGAAAGG + Intergenic
1090324090 11:125870013-125870035 ATTTGATATACAATAGGAAAAGG - Intergenic
1092455556 12:8639576-8639598 GGCTTACATACCATAGGGAAAGG - Intronic
1093022428 12:14216334-14216356 GTTTGATATAACATAGAGAAAGG + Intergenic
1093297537 12:17409851-17409873 GACTGATATACCATGGGGAAAGG + Intergenic
1093327882 12:17802429-17802451 GGCTTATATACCATGGGGAAAGG - Intergenic
1093328969 12:17812450-17812472 GGCTTACATGCCATAGGGAAAGG - Intergenic
1094214841 12:27929926-27929948 GGTGTATCTACCAAAGGGAAAGG - Intergenic
1098021875 12:66164376-66164398 GGCTTATATACCAGAGGGAAAGG + Intronic
1102448499 12:113022740-113022762 GACTTATATACCATAAGGAAAGG - Intergenic
1107100225 13:36582375-36582397 GGGTTATATACCATAGCGAAAGG - Intergenic
1107519295 13:41163365-41163387 GGCCTATATACCATGGGGAAAGG - Intergenic
1107796745 13:44060894-44060916 GGATTATATACCATAGGAAAAGG + Intergenic
1108972720 13:56397497-56397519 GGCTTATATATCACAGGGAAAGG + Intergenic
1109459053 13:62629638-62629660 GGCTTATATACCATAGGGAAGGG + Intergenic
1111058945 13:82987143-82987165 GGTTGATATCCTATATAGAATGG - Intergenic
1113132467 13:107053366-107053388 GGCTTATATGCCATAGGAAAAGG - Intergenic
1116508956 14:45719653-45719675 GGTTGATACAACTTGGGGAATGG + Intergenic
1117286902 14:54294584-54294606 GGCAGATCTATCATAGGGAAAGG - Intergenic
1118485357 14:66209508-66209530 GGCTTATATACCATAGGGGAGGG + Intergenic
1120278494 14:82409140-82409162 GGCTTCTATACCACAGGGAAGGG - Intergenic
1120278505 14:82409175-82409197 GGCTTCTATACCACAGGGAAAGG + Intergenic
1120349277 14:83331598-83331620 GGCTTATATACCACAGGGAAAGG + Intergenic
1120453697 14:84703878-84703900 GGTTTATATATAATAGAGAAAGG - Intergenic
1123838619 15:24223612-24223634 GGTTAATACTCCACAGGGAAAGG - Intergenic
1123852905 15:24379003-24379025 GGCTTATATACCATGGGGAAGGG + Intergenic
1126406383 15:48327086-48327108 GGTTTTTATACCATAGGATAAGG - Intergenic
1129636997 15:77330717-77330739 GTTTTATATACCATAGGTCAGGG - Intronic
1130137156 15:81190826-81190848 GGTTTATATATCATAGGAGAAGG + Intronic
1132524092 16:405753-405775 GGCTTCTATACCACAGGGAAAGG + Intronic
1133059762 16:3166855-3166877 GGTCTACATACCACAGGGAAAGG - Intergenic
1133182943 16:4072463-4072485 GGCTTGTATACCGTAGGGAAGGG - Intronic
1133557114 16:6916074-6916096 GGCTTATATACCTTAGGGAAAGG + Intronic
1134399245 16:13893624-13893646 GGCTTCTGTACCATAGGGAAAGG - Intergenic
1136184089 16:28575111-28575133 GGCTTGTATACCATAGGGAAAGG - Intronic
1138647091 16:58433567-58433589 GGCTTGTATACCATAGAGAAAGG + Intergenic
1139370622 16:66467039-66467061 GGCTTATATATCACAGGGAAAGG + Intronic
1140065401 16:71607044-71607066 GGTTTATACGCCAGAGGGAAGGG - Intergenic
1141417171 16:83884732-83884754 GGCTTATACACCATAGGGGAGGG - Intergenic
1143986445 17:10918807-10918829 GGCTTATATACCATAAAGAAAGG - Intergenic
1144381957 17:14708361-14708383 GGCTTATATACCACAGGAAATGG + Intergenic
1146264161 17:31440430-31440452 GTTTGATATCTGATAGGGAAAGG + Intronic
1148817171 17:50337353-50337375 GGCTTATCTACCACAGGGAAGGG - Intergenic
1148881589 17:50732053-50732075 GGCTTATATGCCATAGGGAAAGG + Intronic
1148888287 17:50789270-50789292 GGCTGCTATACCATTAGGAAGGG + Intergenic
1149149067 17:53537250-53537272 GGCTTCTAAACCATAGGGAAAGG - Intergenic
1149857361 17:60094574-60094596 GGCTGATATACCACAGGAAAAGG - Intergenic
1153172442 18:2331724-2331746 GGATGAAATAGCATAGCGAATGG + Intergenic
1154157101 18:11952179-11952201 GGTTTACACACCATCGGGAAAGG + Intergenic
1156461643 18:37324614-37324636 GGTTGGTACCCCATTGGGAAGGG + Intronic
1158008559 18:52702015-52702037 GGCTTATATACCATACAGAATGG - Intronic
1158849233 18:61477775-61477797 TGTTCATATACCATATGGATGGG - Intronic
1161584766 19:5099371-5099393 GGCTTATATACCATAGGGAAGGG + Intronic
1162160077 19:8705572-8705594 GGCTTATATACCATAGAGAAAGG - Intergenic
1162268391 19:9594810-9594832 GCTTGATATACAACAGGAAAAGG - Intergenic
1162852054 19:13438509-13438531 GGGTGAAAGACCATAGGGAGTGG + Intronic
926993448 2:18706051-18706073 GGCTTATATACCATAGGGAAAGG + Intergenic
927192855 2:20528728-20528750 GGCAGAGATACCAAAGGGAATGG - Intergenic
927761679 2:25761929-25761951 GGTTGAAATACAATACAGAAAGG + Intronic
928253898 2:29705515-29705537 GGTTGATATAAAATAGGGCAAGG - Intronic
933171158 2:79127619-79127641 TGCTTATACACCATAGGGAAAGG + Intergenic
935393790 2:102584050-102584072 GGTTGCTATAGCTAAGGGAAAGG - Intergenic
935764745 2:106355347-106355369 GGCTTACATACCATAGGGAAAGG + Intergenic
939558405 2:143704427-143704449 GGTTGGGATACCATTGGGAAAGG + Intronic
940215340 2:151297740-151297762 GGCTTATATACCACAGGGAAAGG + Intergenic
940487675 2:154316868-154316890 TGTTTATATAACATAGGCAAAGG - Intronic
940504759 2:154539127-154539149 GGCTTATCTACCATAGGGAAAGG - Intergenic
940755999 2:157684177-157684199 GGCTTATATATAATAGGGAAAGG - Intergenic
942211141 2:173671557-173671579 GGGTTATATACCATAGGGAAAGG - Intergenic
942211395 2:173674642-173674664 GGCTTATATACCATAGGGAAAGG + Intergenic
943225960 2:185176536-185176558 GCTAGATATACCATAGGTATAGG - Intergenic
945491961 2:210466543-210466565 GGCTTACATACCATAGGGAAAGG - Intronic
947547171 2:231018442-231018464 AGTTTCTATACCATATGGAAAGG - Intronic
1170588763 20:17755155-17755177 GGGTGTCATACAATAGGGAATGG + Intergenic
1177399239 21:20580781-20580803 GGCTTCTATACCATAGAGAAAGG + Intergenic
1178095482 21:29210707-29210729 GGCTGTTATACCAAAGGCAAAGG + Intronic
1178895505 21:36554007-36554029 GGCTTATATACCATAGGGAAAGG - Intronic
1179520183 21:41938458-41938480 GGTTGATACAACAAAGTGAATGG - Intronic
1179946247 21:44679067-44679089 GGCTTATATACCATAAGGAAAGG - Intronic
1182313744 22:29427940-29427962 GGCTTATATACCATATAGAAAGG - Intergenic
1183666000 22:39245980-39246002 GGCTGACATCCCAAAGGGAAGGG - Intergenic
1184916636 22:47573991-47574013 GGCTTAAATACCACAGGGAAAGG - Intergenic
1185072342 22:48663193-48663215 GTTTCATTTACCATTGGGAAGGG + Intronic
949360874 3:3230967-3230989 GGCTTATACACCATAGGGAAAGG - Intergenic
949887089 3:8704395-8704417 AGTTGTAATACAATAGGGAATGG - Intronic
950414681 3:12862135-12862157 GGTTAAGAGACCATAGGGAAAGG + Intronic
950846667 3:16022090-16022112 ACTTGATATACAATAGGAAAAGG - Intergenic
951508487 3:23475745-23475767 GGCTTTTATACCACAGGGAAAGG + Intronic
953474727 3:43195581-43195603 GGATGGGATAACATAGGGAAAGG - Intergenic
953586978 3:44210512-44210534 GGCTTATATACCAAAGGGAAAGG + Intergenic
955671671 3:61409087-61409109 GGTTGAGAAACTAGAGGGAAGGG - Intergenic
957129816 3:76208763-76208785 GGATTATACAACATAGGGAAAGG - Intronic
959932001 3:111995256-111995278 GGTTGATATAGCATAGTCAGAGG - Intergenic
962910853 3:139848407-139848429 GGGTGAAATACCAAAGTGAATGG + Intergenic
964179020 3:153861027-153861049 TGTTGATAGGTCATAGGGAAAGG - Intergenic
966345814 3:178978510-178978532 GGCTTCTATACCATAGAGAAGGG + Intergenic
966478445 3:180377330-180377352 GACTTATATACCATAGAGAAAGG - Intergenic
966730076 3:183143577-183143599 GGCTTAAATACCATATGGAAAGG - Intronic
967907950 3:194517264-194517286 GGTGGAAAAACTATAGGGAAAGG - Intergenic
968739470 4:2320025-2320047 GGTTAATATTCCCTAGGGAGGGG - Intronic
970614342 4:17753825-17753847 GGTTTATATACCACAGGGAAAGG + Intronic
970686511 4:18573622-18573644 GGCTTATATACCATAGAGAAAGG + Intergenic
971486956 4:27170441-27170463 GGCTTATGTACCATAGGGAAAGG - Intergenic
972136412 4:35900185-35900207 GGCTTATATCCCATAAGGAAAGG - Intergenic
972930678 4:44068278-44068300 GGCTTACATACCATAGGGAAAGG + Intergenic
973644381 4:52935565-52935587 GGTTTACATACCGTAGGGGAGGG - Intronic
975324858 4:73048177-73048199 GGCTTTTATACCATAAGGAAAGG - Intergenic
976735121 4:88301430-88301452 GGTTTATATACCAGAGGTGAGGG + Intergenic
977175799 4:93818042-93818064 GGCTTATATACCATGTGGAAGGG - Intergenic
977481986 4:97590396-97590418 GGCTTATATACTATAGGGAAAGG + Intronic
978299059 4:107244564-107244586 GGTTTCAATACCATAGGCAATGG - Intronic
979399606 4:120232477-120232499 GGATGAGATACCAAAGGCAAAGG + Intergenic
981253491 4:142631977-142631999 GGGTTATATACCACAGGGAAAGG + Intronic
982220404 4:153119736-153119758 GGCTTATGTACTATAGGGAAAGG + Intergenic
982671529 4:158325506-158325528 GGCTTATATACCATAGAGAAAGG + Intronic
983170081 4:164525819-164525841 GGCTTGTGTACCATAGGGAAGGG - Intergenic
983766575 4:171491468-171491490 AGTTTATATACTATAGAGAATGG + Intergenic
985478610 5:93432-93454 GGTTGTGATCCCATAGGGAATGG - Intergenic
986993926 5:13584941-13584963 GGCTTGTATACCACAGGGAAAGG - Intergenic
987175968 5:15309879-15309901 GATTGATATGGCATAGGGACAGG + Intergenic
987193803 5:15504978-15505000 TGATGAGAGACCATAGGGAAAGG + Intronic
987463705 5:18247123-18247145 GGCTTATATACCATAAGGAAAGG - Intergenic
988313201 5:29588633-29588655 TGTTGATATACAAAAGAGAAAGG + Intergenic
989141930 5:38209986-38210008 GGTATATATACCATAGAGAGAGG - Intergenic
989816330 5:45742130-45742152 GGATTATATACCATAGGGGAAGG + Intergenic
992506512 5:77392445-77392467 GGCTTATATACCATACAGAAAGG + Intronic
993586076 5:89730076-89730098 AGTTGATAAACCCTAGGGAATGG - Intergenic
994133728 5:96261438-96261460 GGCTTATATACCATAGGGAAAGG + Intergenic
999166912 5:149557251-149557273 GACTTATATACCACAGGGAAAGG + Intronic
999364874 5:151016256-151016278 GGCTTATATAGCATAGGGAAGGG - Intergenic
1004154460 6:13155283-13155305 GGCTTATATACTATATGGAAAGG - Intronic
1007843056 6:44732257-44732279 GGCTTATATACCACAGGGGAGGG + Intergenic
1009862761 6:69356148-69356170 GGTTTATATACCATAGGGAAAGG + Intronic
1011503227 6:88013440-88013462 GTTGGATATACAGTAGGGAAGGG + Intergenic
1011598587 6:89039500-89039522 GGCTTATGTACCATAGGGTAAGG + Intergenic
1011870861 6:91890762-91890784 GGATGATGTACTATGGGGAAAGG - Intergenic
1012896935 6:104959425-104959447 AGATGATATTCCTTAGGGAAGGG - Intronic
1013831275 6:114275558-114275580 GGTTTTTATAGCATAGGGTAGGG + Intronic
1014601559 6:123419196-123419218 GGCTTCTATACCATAGAGAAAGG + Intronic
1016737944 6:147500740-147500762 GGCTTCTATACCATAGGGGAAGG + Intergenic
1017609628 6:156171557-156171579 GGTAGATATGCTATTGGGAAGGG + Intergenic
1018049825 6:159999173-159999195 GGATCATACACCATAGGGAAGGG + Intronic
1018530656 6:164759352-164759374 GGTTTATAAGCCATATGGAAGGG - Intergenic
1020976569 7:15013911-15013933 GGCTTATATACTATAGGGAAAGG - Intergenic
1021398593 7:20182594-20182616 GGTTTATATACAGTAGGAAAGGG - Intronic
1022735133 7:33069160-33069182 GGCTTATATACCAGTGGGAAGGG + Intergenic
1023754748 7:43406157-43406179 GGCTTATGTACCATAGGGAAGGG - Intronic
1026613752 7:71883763-71883785 CGATTATATACCACAGGGAAAGG - Intronic
1026665952 7:72339946-72339968 GAATGATAGACTATAGGGAATGG - Intronic
1027788758 7:82613406-82613428 GGTTAAAGTACCATATGGAAAGG + Intergenic
1029900361 7:104032713-104032735 GGCTTATATACCACAGAGAAAGG + Intergenic
1031117072 7:117680315-117680337 GGCTTATACACCATAGGGAAAGG - Intronic
1034070555 7:148180647-148180669 GGCCTATATACCATAGAGAAAGG + Intronic
1034097308 7:148421666-148421688 GGCTTATCCACCATAGGGAAAGG + Intergenic
1035285502 7:157803685-157803707 GGAGAATACACCATAGGGAAGGG - Intronic
1036507409 8:9368002-9368024 GGCTTATATAGCATAGGGAAAGG + Intergenic
1038495599 8:27999894-27999916 GGCTTATATAACACAGGGAAGGG - Intergenic
1040729836 8:50430715-50430737 GGCTTGTATACCATAAGGAAGGG + Intronic
1041496341 8:58489109-58489131 GATTGCTATACAATAGGGATTGG + Intergenic
1041511820 8:58661280-58661302 GGCTTATATACCATAGGGGAGGG - Intergenic
1042152710 8:65805657-65805679 GGCTTATACACCATAGGGAAGGG - Intronic
1042198038 8:66250276-66250298 GATTTATATGCCACAGGGAAAGG - Intergenic
1042203266 8:66302723-66302745 AGCTTATATACCACAGGGAAAGG + Intergenic
1042412784 8:68483457-68483479 GGCTTATATATCATAGGGAAAGG + Intronic
1043877353 8:85500763-85500785 GGCTTACATACCACAGGGAAAGG + Intergenic
1044110328 8:88264994-88265016 GGTAGACATACCACAGGGAGAGG - Intronic
1048576834 8:135698597-135698619 GGCTTATATAGCATAGGAAAAGG + Intergenic
1049502031 8:142972045-142972067 GGTTTACGTACCATAGGGAGGGG - Intergenic
1049581737 8:143414866-143414888 AGGTTATATACCATAGGGAAAGG + Intergenic
1053052605 9:34974198-34974220 GGTTGAAAAACCATAGGAGATGG - Intronic
1055200249 9:73649851-73649873 GGCTTATATAGCATAGGGAAAGG - Intergenic
1055509426 9:76980988-76981010 GGTTTATATACTGTAGGAAAAGG - Intergenic
1057615566 9:96586823-96586845 GGTTGATAGAATATAGGGAATGG - Intronic
1058143191 9:101380299-101380321 GGTTGATATACCATAGGGAAAGG - Intronic
1058158582 9:101543042-101543064 GGTAGAAATTCCACAGGGAATGG - Intronic
1058158831 9:101545091-101545113 GGTAGAAATTCCACAGGGAATGG + Intronic
1058615209 9:106818870-106818892 GCTGGATATACCAAAGTGAATGG - Intergenic
1186058129 X:5673171-5673193 GGCTTATATACCATAGGGAAAGG + Intergenic
1186730879 X:12408144-12408166 GGCTTATATACCATAGGGAAAGG + Intronic
1188894713 X:35653041-35653063 GGGTGAAATACAATTGGGAAAGG - Intergenic
1190098333 X:47500774-47500796 GGCTTATATACCATAGGGAAGGG - Intergenic
1190412996 X:50155537-50155559 GGATTATATACCGTAGGGAAGGG + Intergenic
1196997082 X:121395960-121395982 GGTTGATATTTTATTGGGAATGG - Intergenic
1197209716 X:123818834-123818856 GGTTTATACACCATAGGGGAGGG - Intergenic
1199190605 X:144965301-144965323 GGATGATATACCATGAGGGAGGG + Intergenic
1201253657 Y:12086430-12086452 GGCTTATATACCATGGGGTAAGG - Intergenic
1202598467 Y:26568443-26568465 GGTTTACATCCCTTAGGGAAAGG + Intergenic