ID: 1058143193

View in Genome Browser
Species Human (GRCh38)
Location 9:101380304-101380326
Sequence CCCAGGGTTGATATACCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 2, 2: 24, 3: 78, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058143193_1058143202 -2 Left 1058143193 9:101380304-101380326 CCCTATGGTATATCAACCCTGGG 0: 1
1: 2
2: 24
3: 78
4: 171
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143193_1058143201 -3 Left 1058143193 9:101380304-101380326 CCCTATGGTATATCAACCCTGGG 0: 1
1: 2
2: 24
3: 78
4: 171
Right 1058143201 9:101380324-101380346 GGGTCTGGGGAGTAACAGTGAGG No data
1058143193_1058143203 -1 Left 1058143193 9:101380304-101380326 CCCTATGGTATATCAACCCTGGG 0: 1
1: 2
2: 24
3: 78
4: 171
Right 1058143203 9:101380326-101380348 GTCTGGGGAGTAACAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058143193 Original CRISPR CCCAGGGTTGATATACCATA GGG (reversed) Intronic
901384926 1:8901799-8901821 CCCAGGGCTTATATACCATAGGG - Intergenic
901827607 1:11872550-11872572 CCCAGGGCTGCTATAACAAATGG + Intergenic
903484983 1:23682933-23682955 CCCAGGGCTCATATACCATAGGG + Intergenic
903948137 1:26977146-26977168 CCCAGGGCTTATCTACCACAGGG - Intergenic
904712521 1:32441213-32441235 CCCAGGGCTTATTTACCATAGGG + Intergenic
904924507 1:34036992-34037014 CCCAGGGCATATGTACCATAGGG - Intronic
906201447 1:43963072-43963094 CTCAGGGTTCAGATACCAAAGGG + Intronic
907029408 1:51155942-51155964 CCCAAGGCTTATATACCACAGGG + Intergenic
908762142 1:67522326-67522348 CTCAGGGGTTATAAACCATAGGG - Intergenic
909442517 1:75713783-75713805 CCTAGGGCTTATATACCATAAGG - Intergenic
909443143 1:75720142-75720164 CCCAGGGGTTGTATACCACAGGG - Intergenic
909502465 1:76350670-76350692 CACAGAGTTGATATAACACAAGG - Intronic
911022170 1:93400033-93400055 CCCAGGGTTTACATACCACAGGG + Intergenic
911163310 1:94702895-94702917 CTCAGAGTTGATAACCCATAAGG + Intergenic
912824082 1:112889454-112889476 CCCAGGGCTTATACACCATAGGG + Intergenic
913334777 1:117699203-117699225 CCCAGGGATTATATACCACAGGG - Intergenic
914221135 1:145682891-145682913 CCCAAGGCTGATATACCATAGGG - Intronic
914389582 1:147207839-147207861 CCCAGGGATGATATACCACAGGG - Intronic
914473707 1:148005764-148005786 CCCAAGGCTGATATACCATAGGG - Intergenic
916742002 1:167654329-167654351 ACCAGGGATTATATACCATAGGG + Intronic
916868604 1:168887742-168887764 CACTGGGTTGATATTCCAGAGGG - Intergenic
920113914 1:203606446-203606468 CCCAGGGTAGATGTACAATTAGG - Intergenic
921359295 1:214315706-214315728 GCCAGGGCTTATATACCATAGGG + Intronic
923058953 1:230452612-230452634 TCCAAGGCTTATATACCATAGGG + Intergenic
923332613 1:232939626-232939648 CCCAGGGCTTGTATAGCATAAGG - Intergenic
924036180 1:239940895-239940917 CCCAGGGCTTACATACCATAGGG - Intergenic
924473632 1:244365082-244365104 CCCAGGATTTAGATACCATAGGG + Intronic
924924869 1:248670469-248670491 CCCAGGACTTATATGCCATAGGG - Intergenic
1064061577 10:12142014-12142036 CCCAGGGCTAATCTATCATAGGG + Intronic
1064720925 10:18227670-18227692 CCCAGCGCTTATCTACCATAGGG + Intronic
1065997723 10:31074807-31074829 CCCAGGGCTTATATACTATAGGG + Intergenic
1067373162 10:45703519-45703541 CCCAGGGCTTCTATAGCATAGGG - Intergenic
1067386614 10:45822603-45822625 CCCAGGGCTTCTATAGCATAGGG + Intergenic
1067447655 10:46361997-46362019 CCCAGGGCTTCTATAGCATAGGG - Intergenic
1067513898 10:46920466-46920488 CTCAGGGCTTATATACCATAGGG + Intronic
1067589724 10:47498763-47498785 CCCAGGGCTTCTATAGCATAGGG + Intergenic
1067636848 10:48006870-48006892 CCCAGGGCTTCTATAGCATAGGG + Intergenic
1067648356 10:48131368-48131390 CTCAGGGCTTATATACCATAGGG - Intergenic
1067791449 10:49291354-49291376 CCCAGGGCTCATATACCACAGGG - Intergenic
1067876642 10:50013472-50013494 CCCAGGGCTTCTATAGCATAGGG - Intergenic
1069578673 10:69549382-69549404 CCCAGGGTTTATATACCATAGGG - Intergenic
1069583986 10:69584868-69584890 ACCAGGGTTTATATACCACACGG - Intergenic
1070133394 10:73670885-73670907 CCCAGGGCTTCTATAGCATAGGG + Intergenic
1071014497 10:80979282-80979304 CCCAAGGCTTATATACCACAGGG - Intergenic
1071608277 10:87013195-87013217 CCCAGGGCTTCTATAGCATAGGG - Intergenic
1071658866 10:87478225-87478247 CCCAAGGTTTGTGTACCATATGG + Intergenic
1071781996 10:88856341-88856363 CCCCGGGCTTATATATCATAAGG - Intergenic
1075118534 10:119647437-119647459 CCCAGGGCTTGTATACCACAGGG + Intergenic
1076342752 10:129760780-129760802 CCCAGGAGTGAGATACCACAGGG + Intronic
1077939992 11:6831005-6831027 CCAAGGGCTTATATACCATAGGG - Intergenic
1077977764 11:7265868-7265890 CACAGGGTTTATGTACCGTATGG - Intronic
1078385426 11:10887671-10887693 CTCAGGGCTTATATACCACAGGG - Intergenic
1078697140 11:13645786-13645808 CCCAGGGCTTATATACCACAGGG + Intergenic
1078698866 11:13661659-13661681 CACAGGGCTTATACACCATAGGG + Intergenic
1079885885 11:25988217-25988239 CCCAGGGTTTATATGCCATAGGG + Intergenic
1081200910 11:40214272-40214294 CCCAGGGATTATATACCATAGGG - Intronic
1083083227 11:60114812-60114834 CTCAGGGTTTATATACTATAGGG - Intergenic
1083517132 11:63270600-63270622 CCCAGGGCTTATAGACAATAGGG - Intronic
1084104121 11:66969597-66969619 CCCAGGGCTTATATACCACAGGG + Intergenic
1085179180 11:74519402-74519424 CCCAGGGTGGAAATACAGTAGGG - Intronic
1085411758 11:76295520-76295542 CCCAGGGCTTATATACCATAGGG - Intergenic
1085467865 11:76736478-76736500 CCCAGGGCTTATCTACCATAGGG + Intergenic
1087490866 11:98825389-98825411 CCCAGGATTTATATGCCATAGGG - Intergenic
1089204314 11:116746642-116746664 ACAAGGGTTTATATACCAGAGGG + Intergenic
1089853418 11:121519370-121519392 CCCAGGCTTTATCTACCATGCGG - Intronic
1091891048 12:4054857-4054879 CCCAGGTTTGATTAACCATCTGG + Intergenic
1092455558 12:8639581-8639603 CCCAGGGCTTACATACCATAGGG - Intronic
1093104803 12:15073411-15073433 CCCAGGGCGTATATACCATAGGG - Intergenic
1093327884 12:17802434-17802456 CCCAAGGCTTATATACCATGGGG - Intergenic
1095783587 12:46086718-46086740 CCCAGTGTTCATCCACCATAAGG - Intergenic
1096697450 12:53358950-53358972 TCCAGAATTTATATACCATAGGG + Intergenic
1097322728 12:58244213-58244235 CCCAGGGATTATAGACCACAGGG - Intergenic
1098021874 12:66164371-66164393 CCTAGGGCTTATATACCAGAGGG + Intronic
1098065857 12:66615454-66615476 CCCAGGTATAATATACGATAAGG - Intronic
1098705184 12:73678112-73678134 CCCAGTGCTTATATCCCATAGGG - Intergenic
1100044088 12:90357236-90357258 CCCAGGGCTTACATACCAGAGGG + Intergenic
1102448501 12:113022745-113022767 CCCAGGACTTATATACCATAAGG - Intergenic
1102595881 12:113992284-113992306 CCCAGGGCTTACCTACCATAGGG + Intergenic
1104009674 12:124920993-124921015 CCCAGGGCTTCCATACCATAGGG - Intergenic
1104823731 12:131693838-131693860 CCCAGGGCTCATGGACCATAGGG + Intergenic
1105713188 13:23033311-23033333 CCCAGGGCTTATATACCGCAGGG + Intergenic
1106940174 13:34769549-34769571 CCCAGGACTCATATACCATAGGG - Intergenic
1108500737 13:51067547-51067569 TCCACGGGTGATATGCCATATGG - Intergenic
1108972718 13:56397492-56397514 CCCAGGGCTTATATATCACAGGG + Intergenic
1109459051 13:62629633-62629655 CTCAGGGCTTATATACCATAGGG + Intergenic
1110658431 13:78029023-78029045 CTCAGGGCTTATAAACCATAGGG - Intergenic
1114216494 14:20661192-20661214 CAAAGGGTTCATATCCCATATGG + Intergenic
1114233657 14:20805442-20805464 CCCAGAGCTTATATACCATAGGG + Intergenic
1114282720 14:21208614-21208636 ACCAGGATTGAAATACCACATGG - Intergenic
1114591007 14:23864710-23864732 CCCAGGCTTAATTTACCCTAAGG + Intergenic
1116463907 14:45210858-45210880 CCCAGGGTTTATATACCATAGGG - Intronic
1118485353 14:66209503-66209525 CCCAGGGCTTATATACCATAGGG + Intergenic
1119429758 14:74558749-74558771 CCCAGGGTTCAAATCCCTTAAGG + Intronic
1121658549 14:95616922-95616944 CCCAGGGCTTATATACCACAGGG - Intergenic
1123838621 15:24223617-24223639 CCCAGGGTTAATACTCCACAGGG - Intergenic
1123867253 15:24533541-24533563 CCCAGGGTTAATACTCCACAGGG - Intergenic
1124090548 15:26595872-26595894 TCCAGGGCTTATATAGCATAGGG - Intronic
1128727302 15:69997700-69997722 CCCAGGGCTCGTATGCCATAGGG + Intergenic
1128901985 15:71431731-71431753 CCCAAGGCTTGTATACCATAGGG + Intronic
1129381509 15:75170622-75170644 CCAAGGGCTTATATACCATAGGG - Intergenic
1130930181 15:88420663-88420685 CCCAGGGCTTATATACCACAGGG + Intergenic
1131229684 15:90650985-90651007 CCCAGGGCATATATACCATAGGG - Intergenic
1132524090 16:405748-405770 CCCAGGGCTTCTATACCACAGGG + Intronic
1133059764 16:3166860-3166882 CCCAGGGTCTACATACCACAGGG - Intergenic
1133182946 16:4072468-4072490 CCCAGGGCTTGTATACCGTAGGG - Intronic
1133557112 16:6916069-6916091 CCCAGGGCTTATATACCTTAGGG + Intronic
1134613256 16:15627976-15627998 TCCTGGGCTGACATACCATAGGG - Intronic
1136000285 16:27287230-27287252 ACCAGGGCTTATATACCATAGGG + Intronic
1136184091 16:28575116-28575138 CCCAGGGCTTGTATACCATAGGG - Intronic
1139370620 16:66467034-66467056 CCCAGGGCTTATATATCACAGGG + Intronic
1141417175 16:83884737-83884759 TCCAGGGCTTATACACCATAGGG - Intergenic
1143127138 17:4649814-4649836 CCCAGGCCTTATATATCATACGG - Intergenic
1145000314 17:19300283-19300305 GCCAGGGCTTATATGCCATAGGG + Intronic
1148804106 17:50255638-50255660 CCCAGGGCTTGTATACCACAGGG + Intergenic
1148817174 17:50337358-50337380 CCCAGGGCTTATCTACCACAGGG - Intergenic
1148881587 17:50732048-50732070 CCCAGGGCTTATATGCCATAGGG + Intronic
1149149069 17:53537255-53537277 CCCAGGGCTTCTAAACCATAGGG - Intergenic
1154157099 18:11952174-11952196 CCCAGGGTTTACACACCATCGGG + Intergenic
1158038885 18:53069046-53069068 CCGAGGGCTTATATACCATGGGG + Intronic
1159054017 18:63447558-63447580 CCCAGGGCTTATATACCATAGGG - Intergenic
1160344427 18:78121190-78121212 CCCAGGGCTCATACGCCATAGGG + Intergenic
1160533432 18:79578326-79578348 CCCAGGGTTGCTGTCCCATCAGG - Intergenic
1161584763 19:5099366-5099388 CCCAGGGCTTATATACCATAGGG + Intronic
1162159916 19:8704198-8704220 CCCAAGGCTTATATACCATAGGG + Intergenic
1165595219 19:37007322-37007344 TCCTGGCTTTATATACCATAGGG + Intergenic
1167673103 19:50867131-50867153 CCCAGGGCTTATATGCCATAGGG - Intronic
925267717 2:2578676-2578698 TACAGGGTTGCTAGACCATATGG - Intergenic
926204313 2:10824371-10824393 CCCAGGGTTGCTACACAATGGGG - Intronic
927855483 2:26525047-26525069 CCCTGGGGTGAGATACCATGAGG - Intronic
928911750 2:36429038-36429060 CCCACAGTTGGAATACCATATGG + Intronic
929123764 2:38504390-38504412 CCCAGGCTTCATCTAGCATAAGG - Intergenic
929484762 2:42343302-42343324 CTTAGGGTTGATAGACCACATGG - Intronic
929589949 2:43138413-43138435 CCCAGGGTTGATGGAGAATAAGG - Intergenic
931533361 2:63242996-63243018 CCCAGGATTGTTATACAAGAAGG + Intronic
931697953 2:64885844-64885866 CCCAGGGCTTATATACCATAGGG + Intergenic
933171156 2:79127614-79127636 CCCAGTGCTTATACACCATAGGG + Intergenic
935484144 2:103632100-103632122 CCCAGGGCTTATACACCACAGGG - Intergenic
935764744 2:106355342-106355364 CTCAGGGCTTACATACCATAGGG + Intergenic
936514205 2:113171582-113171604 CCCAGGGCTCATATACCATAGGG + Intronic
936809736 2:116383887-116383909 CTCAGGCTTTATATACCATGTGG - Intergenic
936890095 2:117359534-117359556 CACTGGGTTGATATTCCAGAAGG - Intergenic
940111518 2:150160170-150160192 CCCAGTTTTGTTATACCATGAGG + Intergenic
940215338 2:151297735-151297757 CCCAGGGCTTATATACCACAGGG + Intergenic
940504761 2:154539132-154539154 ACCAGGGCTTATCTACCATAGGG - Intergenic
940756001 2:157684182-157684204 CCCAGGGCTTATATATAATAGGG - Intergenic
941030920 2:160510785-160510807 TCCAGGGTTGATATTGCCTAAGG + Intergenic
941985277 2:171504629-171504651 CCCAGGGCTTATCTACCACAGGG - Intergenic
942211393 2:173674637-173674659 CCCAGGGCTTATATACCATAGGG + Intergenic
944079349 2:195769576-195769598 CCCAGGGCTGATGCATCATAGGG - Intronic
945090744 2:206173387-206173409 CCCAGGGCTTATATACCTTAGGG + Intergenic
945491963 2:210466548-210466570 CCCAGGGCTTACATACCATAGGG - Intronic
946387204 2:219391141-219391163 CCCAGGGCTTACATACCATAGGG - Intronic
1170733138 20:18991081-18991103 CCCAGGGCTTGTATGCCATAGGG - Intergenic
1171165370 20:22965727-22965749 CCCAAGGCTTACATACCATAAGG - Intergenic
1171379619 20:24724536-24724558 CCCAGGGCTTATATACCATAGGG - Intergenic
1173481834 20:43407388-43407410 CCCAGGGCTTTTATACCATAGGG + Intergenic
1175519385 20:59590251-59590273 CCTAGTGTGGATATACCGTAGGG + Intronic
1178895508 21:36554012-36554034 ACCCGGGCTTATATACCATAGGG - Intronic
1179414670 21:41188571-41188593 CCCAGGGCTTACATACCATAGGG + Intronic
1179946249 21:44679072-44679094 CCCAAGGCTTATATACCATAAGG - Intronic
1180255984 21:46627845-46627867 CCCAGGGCTTATAGACCATAGGG + Intergenic
1184916638 22:47573996-47574018 CCCAGGGCTTAAATACCACAGGG - Intergenic
949360876 3:3230972-3230994 CCCAGGGCTTATACACCATAGGG - Intergenic
950905437 3:16533692-16533714 CCCAGGGCTTATATACCATAAGG + Intergenic
952705094 3:36369228-36369250 CCAAGGGCTTATATACCATAGGG - Intergenic
953586976 3:44210507-44210529 ACCAGGGCTTATATACCAAAGGG + Intergenic
953702318 3:45206381-45206403 CCCTGGGCTTATATACCACAAGG + Intergenic
960244216 3:115381602-115381624 GCCAGGGTTTCTCTACCATATGG + Intergenic
961481478 3:127183530-127183552 CCCAGGGTCCATAGACCAAATGG - Intergenic
965492808 3:169360712-169360734 GCCAGGGTTGTTATTTCATATGG + Intronic
966533812 3:181008890-181008912 CACAGGGTGTATATACCATAGGG + Intergenic
966730078 3:183143582-183143604 CCCAGGGCTTAAATACCATATGG - Intronic
966865427 3:184256418-184256440 CCCAGGGTTGATATCTTCTAAGG + Intronic
969722757 4:8901711-8901733 CCCAGGGGTTATATGCCACAGGG - Intergenic
970614341 4:17753820-17753842 CCTGGGGTTTATATACCACAGGG + Intronic
970759705 4:19469812-19469834 CCCAGTGCTCTTATACCATAGGG - Intergenic
971486958 4:27170446-27170468 CCCGGGGCTTATGTACCATAGGG - Intergenic
972930676 4:44068273-44068295 CCCAGGGCTTACATACCATAGGG + Intergenic
973276980 4:48320242-48320264 CTCAGGGTTGATATAACAGGTGG + Intergenic
973644385 4:52935570-52935592 CCCAGGGTTTACATACCGTAGGG - Intronic
973811498 4:54574765-54574787 ACCAGGGTTGATACACTACATGG - Intergenic
975324860 4:73048182-73048204 CCCAGGGCTTTTATACCATAAGG - Intergenic
976023434 4:80659143-80659165 CCCAGTATTAATATAGCATATGG - Intronic
976040054 4:80873113-80873135 CCCAGTATTAATATAGCATATGG + Intronic
977105091 4:92872768-92872790 CCCAGGGCTTATATACCATAGGG + Intronic
977481984 4:97590391-97590413 TCCAGGGCTTATATACTATAGGG + Intronic
977715422 4:100177178-100177200 ACCAGGGTTTATTTACCTTAGGG - Intergenic
979998914 4:127465840-127465862 CCCAGGGCTTATATAGCATAGGG - Intergenic
981253489 4:142631972-142631994 CCCAAGGGTTATATACCACAGGG + Intronic
982059167 4:151585620-151585642 CCCTGGTTTGATATTCCACAAGG + Intronic
984373118 4:178892070-178892092 CACAGGAATGATATACCATCTGG - Intergenic
985681026 5:1255868-1255890 CCCAGGGTTTATGCACCACAGGG - Intronic
986993928 5:13584946-13584968 CCCAGGGCTTGTATACCACAGGG - Intergenic
987463707 5:18247128-18247150 CCCAGGGCTTATATACCATAAGG - Intergenic
987968942 5:24916881-24916903 GTCAGAGTTGATATACCGTAAGG - Intergenic
989816327 5:45742125-45742147 CCCAGGGATTATATACCATAGGG + Intergenic
992438688 5:76779567-76779589 CCCAGGGTTGGAAGCCCATATGG - Intergenic
993416172 5:87635395-87635417 ACCAGGGATTATATACCATAGGG - Intergenic
993539051 5:89125325-89125347 CCCATGGCTTATATACCATAGGG + Intergenic
993652482 5:90538917-90538939 CTCAGGGATAATATACCATAGGG + Intronic
994133726 5:96261433-96261455 TCCAGGGCTTATATACCATAGGG + Intergenic
994578113 5:101607574-101607596 CCCAGGACTTATATACCATAGGG - Intergenic
997228951 5:132228869-132228891 CCCAGTGTGGATATTCCCTACGG + Intronic
999166910 5:149557246-149557268 CCCAGGACTTATATACCACAGGG + Intronic
999364877 5:151016261-151016283 CCCAGGGCTTATATAGCATAGGG - Intergenic
1000122706 5:158212523-158212545 CCCAGGGCTTATAGACCATAAGG - Intergenic
1001073062 5:168603689-168603711 CCCAGGGATGCTAAACCATGGGG + Intergenic
1002631932 5:180588055-180588077 CCCAGGGTTTGTATATCACAGGG - Intergenic
1004154462 6:13155288-13155310 CCCAGGGCTTATATACTATATGG - Intronic
1005877132 6:30019639-30019661 CCCAGGGCTTATATACCACAGGG - Intergenic
1007843052 6:44732252-44732274 CCCAGGGCTTATATACCACAGGG + Intergenic
1008096787 6:47347157-47347179 CCCAGGGCTTATATACCACAGGG - Intergenic
1009862760 6:69356143-69356165 CACAGGGTTTATATACCATAGGG + Intronic
1011598585 6:89039495-89039517 CCCAGGGCTTATGTACCATAGGG + Intergenic
1016737941 6:147500735-147500757 CCCAAGGCTTCTATACCATAGGG + Intergenic
1017045694 6:150345277-150345299 TGCAGGGCTCATATACCATAGGG + Intergenic
1018049822 6:159999168-159999190 CCCAGGGATCATACACCATAGGG + Intronic
1020453969 7:8351041-8351063 CCCTGAGATAATATACCATAAGG + Intergenic
1020976570 7:15013916-15013938 CTCAGGGCTTATATACTATAGGG - Intergenic
1023754751 7:43406162-43406184 CCCAGGGCTTATGTACCATAGGG - Intronic
1026613754 7:71883768-71883790 CCCAGCGATTATATACCACAGGG - Intronic
1026639068 7:72108679-72108701 CCCAGGACTTATATATCATAGGG - Intronic
1027152988 7:75745996-75746018 CCCAAGGCTTATATACCACAGGG + Intergenic
1031117075 7:117680320-117680342 CCCCGGGCTTATACACCATAGGG - Intronic
1032637481 7:133725673-133725695 GCCAGGGTTGACATTTCATAGGG + Intronic
1034097306 7:148421661-148421683 CCCAGGGCTTATCCACCATAGGG + Intergenic
1034301188 7:150016732-150016754 CCCAAGGCTTATATACCATAGGG + Intergenic
1034804865 7:154080574-154080596 CCCAAGGCTTATCTACCATAGGG - Intronic
1036507407 8:9367997-9368019 ACCAGGGCTTATATAGCATAGGG + Intergenic
1037469309 8:19191734-19191756 CCCAGGGCTTATATACCATGGGG + Intergenic
1037559362 8:20058790-20058812 CCCAGAGCTCATATACCATAGGG + Intergenic
1038495602 8:27999899-27999921 CCCAGGGCTTATATAACACAGGG - Intergenic
1038972602 8:32653504-32653526 GCCAGGGGTGATTCACCATATGG + Intronic
1039284157 8:36022239-36022261 CCCAGGGCTTATGTACCATATGG - Intergenic
1039698337 8:39936575-39936597 CCCAGGGCTTATATACCACAGGG + Intronic
1040729833 8:50430710-50430732 TCCAGGGCTTGTATACCATAAGG + Intronic
1041511823 8:58661285-58661307 CTTAGGGCTTATATACCATAGGG - Intergenic
1041990036 8:63976440-63976462 CCCAGGGCTGATATATCAGAGGG + Intergenic
1042152713 8:65805662-65805684 ACCAGGGCTTATACACCATAGGG - Intronic
1042198040 8:66250281-66250303 CCCAGGATTTATATGCCACAGGG - Intergenic
1042412782 8:68483452-68483474 CCCAGGGCTTATATATCATAGGG + Intronic
1042689139 8:71477684-71477706 CACAGGGTTATTCTACCATATGG + Intronic
1042834625 8:73068175-73068197 GCCAGGGTTTAAATACTATATGG + Intronic
1043877351 8:85500758-85500780 CCCAGGGCTTACATACCACAGGG + Intergenic
1047383543 8:124386760-124386782 CCCAGGGCTTATGTACCCTAGGG + Intergenic
1047634406 8:126744515-126744537 CACTGGGTTGATGTTCCATAGGG + Intergenic
1049502035 8:142972050-142972072 ACCAGGGTTTACGTACCATAGGG - Intergenic
1049581735 8:143414861-143414883 CCCAGAGGTTATATACCATAGGG + Intergenic
1051001037 9:12281802-12281824 CTCAGGGCTTATATACCATGGGG + Intergenic
1051096291 9:13469459-13469481 TCTAGGGCTTATATACCATAGGG + Intergenic
1052828757 9:33197718-33197740 CCCAGGATTGATTTATGATATGG + Intergenic
1053320350 9:37092868-37092890 CCCAGGGCTGTTTTAGCATATGG - Intergenic
1055197238 9:73611211-73611233 CCTAGGGCTTATATAACATAGGG + Intergenic
1055200250 9:73649856-73649878 CTCAGGGCTTATATAGCATAGGG - Intergenic
1055689042 9:78809987-78810009 CCCAAGGCTCATAAACCATATGG - Intergenic
1056900988 9:90599225-90599247 CCCATGGTTGAGAGACCACAAGG - Intergenic
1057290077 9:93800855-93800877 CCCAGGGCTTATATACTATAAGG + Intergenic
1058143193 9:101380304-101380326 CCCAGGGTTGATATACCATAGGG - Intronic
1062372740 9:136248539-136248561 CCCAGGGCTTATCTGCCATAGGG - Intergenic
1186058127 X:5673166-5673188 CCCAGGGCTTATATACCATAGGG + Intergenic
1186730877 X:12408139-12408161 CCCAGGGCTTATATACCATAGGG + Intronic
1187334923 X:18373642-18373664 CCCAGGATTGATCTAACCTAAGG + Intergenic
1188328999 X:28845211-28845233 CCCAGGGTTTACATAGCTTAGGG + Intronic
1188444142 X:30239289-30239311 CCCAGGAGTGATATAAGATAGGG - Intergenic
1189736016 X:44070655-44070677 CCCAGGGCTTATATACCATAGGG + Intergenic
1190098335 X:47500779-47500801 CTCAGGGCTTATATACCATAGGG - Intergenic
1190230978 X:48581656-48581678 CCCACGGCTTACATACCATAGGG + Intergenic
1190412993 X:50155532-50155554 CCCGGGGATTATATACCGTAGGG + Intergenic
1194288856 X:92043404-92043426 TCCTGGGTTGTTATCCCATAAGG + Intronic
1194597434 X:95876009-95876031 CCCAGGGCTTATATATCATCAGG - Intergenic
1195630275 X:107048703-107048725 CCCAGAGTTTATATACAACAGGG + Intergenic
1197209719 X:123818839-123818861 CCTAGGGTTTATACACCATAGGG - Intergenic
1199190601 X:144965296-144965318 CCCAGGGATGATATACCATGAGG + Intergenic
1200417972 Y:2933349-2933371 CCCATTCTTGACATACCATAAGG + Intergenic
1200606376 Y:5267971-5267993 TCCTGGGTTGTTATCCCATAAGG + Intronic
1201253659 Y:12086435-12086457 CCCAGGGCTTATATACCATGGGG - Intergenic