ID: 1058143195

View in Genome Browser
Species Human (GRCh38)
Location 9:101380305-101380327
Sequence ACCCAGGGTTGATATACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 2, 2: 28, 3: 79, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058143195_1058143202 -3 Left 1058143195 9:101380305-101380327 CCTATGGTATATCAACCCTGGGT 0: 1
1: 2
2: 28
3: 79
4: 168
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143195_1058143203 -2 Left 1058143195 9:101380305-101380327 CCTATGGTATATCAACCCTGGGT 0: 1
1: 2
2: 28
3: 79
4: 168
Right 1058143203 9:101380326-101380348 GTCTGGGGAGTAACAGTGAGGGG No data
1058143195_1058143201 -4 Left 1058143195 9:101380305-101380327 CCTATGGTATATCAACCCTGGGT 0: 1
1: 2
2: 28
3: 79
4: 168
Right 1058143201 9:101380324-101380346 GGGTCTGGGGAGTAACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058143195 Original CRISPR ACCCAGGGTTGATATACCAT AGG (reversed) Intronic
901384928 1:8901800-8901822 ACCCAGGGCTTATATACCATAGG - Intergenic
903484981 1:23682932-23682954 ACCCAGGGCTCATATACCATAGG + Intergenic
903948139 1:26977147-26977169 ACCCAGGGCTTATCTACCACAGG - Intergenic
904712519 1:32441212-32441234 ACCCAGGGCTTATTTACCATAGG + Intergenic
904924509 1:34036993-34037015 ACCCAGGGCATATGTACCATAGG - Intronic
906201446 1:43963071-43963093 ACTCAGGGTTCAGATACCAAAGG + Intronic
906592004 1:47033834-47033856 ACCCAGGAATTATAGACCATGGG + Intronic
907029406 1:51155941-51155963 ACCCAAGGCTTATATACCACAGG + Intergenic
908313360 1:62907931-62907953 ACCAAGGGTGGAGATACCTTGGG + Intergenic
908762143 1:67522327-67522349 ACTCAGGGGTTATAAACCATAGG - Intergenic
909443145 1:75720143-75720165 ACCCAGGGGTTGTATACCACAGG - Intergenic
909811516 1:79937154-79937176 ACCCAAGGTGAATATACTATAGG + Intergenic
911022168 1:93400032-93400054 GCCCAGGGTTTACATACCACAGG + Intergenic
912824080 1:112889453-112889475 ACCCAGGGCTTATACACCATAGG + Intergenic
913334779 1:117699204-117699226 ACCCAGGGATTATATACCACAGG - Intergenic
914221137 1:145682892-145682914 ACCCAAGGCTGATATACCATAGG - Intronic
914389584 1:147207840-147207862 ACCCAGGGATGATATACCACAGG - Intronic
914473709 1:148005765-148005787 ACCCAAGGCTGATATACCATAGG - Intergenic
916742001 1:167654328-167654350 GACCAGGGATTATATACCATAGG + Intronic
921359294 1:214315705-214315727 AGCCAGGGCTTATATACCATAGG + Intronic
921990393 1:221359891-221359913 ACCTAGTGTTGATATATCAAAGG - Intergenic
924036182 1:239940896-239940918 ACCCAGGGCTTACATACCATAGG - Intergenic
924473630 1:244365081-244365103 ACCCAGGATTTAGATACCATAGG + Intronic
924924871 1:248670470-248670492 ACCCAGGACTTATATGCCATAGG - Intergenic
1064061575 10:12142013-12142035 ACCCAGGGCTAATCTATCATAGG + Intronic
1064306248 10:14169447-14169469 ACCCAGGGCTTATCCACCATAGG - Intronic
1064720923 10:18227669-18227691 ACCCAGCGCTTATCTACCATAGG + Intronic
1065997721 10:31074806-31074828 ACCCAGGGCTTATATACTATAGG + Intergenic
1066363245 10:34751528-34751550 ACCCAGGGCTGATACACTGTGGG - Intronic
1067373164 10:45703520-45703542 ACCCAGGGCTTCTATAGCATAGG - Intergenic
1067386612 10:45822602-45822624 ACCCAGGGCTTCTATAGCATAGG + Intergenic
1067447657 10:46361998-46362020 ACCCAGGGCTTCTATAGCATAGG - Intergenic
1067461128 10:46459520-46459542 ACCCAAGGCTTATATACCAAGGG - Intergenic
1067513897 10:46920465-46920487 ACTCAGGGCTTATATACCATAGG + Intronic
1067589722 10:47498762-47498784 ACCCAGGGCTTCTATAGCATAGG + Intergenic
1067626066 10:47925081-47925103 ACCCAAGGCTTATATACCAAGGG + Intergenic
1067636846 10:48006869-48006891 ACCCAGGGCTTCTATAGCATAGG + Intergenic
1067648357 10:48131369-48131391 ACTCAGGGCTTATATACCATAGG - Intergenic
1067791451 10:49291355-49291377 ACCCAGGGCTCATATACCACAGG - Intergenic
1067876644 10:50013473-50013495 ACCCAGGGCTTCTATAGCATAGG - Intergenic
1068262712 10:54603600-54603622 ACCCAGGGCTTATATACTATAGG + Intronic
1069041784 10:63703515-63703537 CCCCATGGTTGTCATACCATTGG - Intergenic
1069578675 10:69549383-69549405 ACCCAGGGTTTATATACCATAGG - Intergenic
1070133392 10:73670884-73670906 ACCCAGGGCTTCTATAGCATAGG + Intergenic
1070921851 10:80192114-80192136 ACCCAGGCTTGAACTCCCATGGG - Intronic
1071608279 10:87013196-87013218 ACCCAGGGCTTCTATAGCATAGG - Intergenic
1071707623 10:88016422-88016444 GCCCAGGGCTTATATACCATAGG + Intergenic
1072789509 10:98307988-98308010 ACCCAGGATGGATGGACCATTGG - Intergenic
1074844464 10:117384973-117384995 AGCCAGGGCTTATATTCCATAGG + Intergenic
1075274452 10:121080652-121080674 TCCCAGGGTTTATTTACCCTTGG - Intergenic
1077939994 11:6831006-6831028 ACCAAGGGCTTATATACCATAGG - Intergenic
1078385427 11:10887672-10887694 ACTCAGGGCTTATATACCACAGG - Intergenic
1078697138 11:13645785-13645807 ACCCAGGGCTTATATACCACAGG + Intergenic
1078698865 11:13661658-13661680 ACACAGGGCTTATACACCATAGG + Intergenic
1079885883 11:25988216-25988238 ACCCAGGGTTTATATGCCATAGG + Intergenic
1081200912 11:40214273-40214295 ACCCAGGGATTATATACCATAGG - Intronic
1083069953 11:59968037-59968059 ACCCAAGTTTGATATAACATTGG - Intergenic
1083083228 11:60114813-60114835 ACTCAGGGTTTATATACTATAGG - Intergenic
1084104119 11:66969596-66969618 ACCCAGGGCTTATATACCACAGG + Intergenic
1085278332 11:75314172-75314194 ACACAGGGTGGAGAAACCATGGG + Intronic
1085411760 11:76295521-76295543 ACCCAGGGCTTATATACCATAGG - Intergenic
1085467863 11:76736477-76736499 ACCCAGGGCTTATCTACCATAGG + Intergenic
1087490868 11:98825390-98825412 ACCCAGGATTTATATGCCATAGG - Intergenic
1088045014 11:105439746-105439768 ACCCAGGGTTTATACACTATAGG + Intergenic
1089522870 11:119077262-119077284 ACCCTGGGCTTAGATACCATGGG - Intronic
1090938187 11:131364006-131364028 AGCCAGTGTTGATATAAAATTGG - Intergenic
1092455560 12:8639582-8639604 ACCCAGGGCTTACATACCATAGG - Intronic
1093104805 12:15073412-15073434 ACCCAGGGCGTATATACCATAGG - Intergenic
1093297535 12:17409845-17409867 ACTCGGGACTGATATACCATGGG + Intergenic
1093327886 12:17802435-17802457 ACCCAAGGCTTATATACCATGGG - Intergenic
1094572206 12:31651015-31651037 ACCCAGGGCTTATATACCCCAGG + Intronic
1095586018 12:43850194-43850216 ACGCAGGGCTTATACACCATGGG + Intronic
1096697449 12:53358949-53358971 ATCCAGAATTTATATACCATAGG + Intergenic
1097322730 12:58244214-58244236 ACCCAGGGATTATAGACCACAGG - Intergenic
1098021872 12:66164370-66164392 ACCTAGGGCTTATATACCAGAGG + Intronic
1098547878 12:71731487-71731509 ACCCAGGACTTACATACCATAGG + Intergenic
1098705186 12:73678113-73678135 ACCCAGTGCTTATATCCCATAGG - Intergenic
1098805890 12:75019999-75020021 ACCAAGGGTTTTTATTCCATTGG - Intergenic
1100044086 12:90357235-90357257 ACCCAGGGCTTACATACCAGAGG + Intergenic
1102595879 12:113992283-113992305 ACCCAGGGCTTACCTACCATAGG + Intergenic
1103290652 12:119843460-119843482 AGCCAGGAGGGATATACCATAGG + Intronic
1104823729 12:131693837-131693859 ACCCAGGGCTCATGGACCATAGG + Intergenic
1105713186 13:23033310-23033332 ACCCAGGGCTTATATACCGCAGG + Intergenic
1106198921 13:27520194-27520216 ACCCATGGTGTATATGCCATAGG + Intergenic
1106940176 13:34769550-34769572 ACCCAGGACTCATATACCATAGG - Intergenic
1107796742 13:44060888-44060910 ACCCAGGGATTATATACCATAGG + Intergenic
1108972716 13:56397491-56397513 ACCCAGGGCTTATATATCACAGG + Intergenic
1109459050 13:62629632-62629654 ACTCAGGGCTTATATACCATAGG + Intergenic
1110771142 13:79348074-79348096 ATTCAAGGTTGATTTACCATTGG - Intronic
1111794433 13:92899748-92899770 AGCAAGGGTTGAAATACTATTGG + Intergenic
1111932131 13:94523412-94523434 ACTCAGGGCTTAGATACCATAGG - Intergenic
1113132470 13:107053372-107053394 ACCCAGGGCTTATATGCCATAGG - Intergenic
1114233655 14:20805441-20805463 ACCCAGAGCTTATATACCATAGG + Intergenic
1116463909 14:45210859-45210881 ACCCAGGGTTTATATACCATAGG - Intronic
1118485351 14:66209502-66209524 ACCCAGGGCTTATATACCATAGG + Intergenic
1121658551 14:95616923-95616945 ACCCAGGGCTTATATACCACAGG - Intergenic
1122472440 14:101979592-101979614 ACACAGGGTTTATATCCCCTCGG - Intronic
1123838623 15:24223618-24223640 ACCCAGGGTTAATACTCCACAGG - Intergenic
1123852902 15:24378997-24379019 ACATAGGGCTTATATACCATGGG + Intergenic
1123867255 15:24533542-24533564 ACCCAGGGTTAATACTCCACAGG - Intergenic
1123868753 15:24550414-24550436 ACACAGGACTTATATACCATGGG + Intergenic
1124090549 15:26595873-26595895 ATCCAGGGCTTATATAGCATAGG - Intronic
1124395831 15:29300471-29300493 ACCCAGTGATTATCTACCATTGG - Intronic
1124556537 15:30731157-30731179 ACCCAGGGATGAAATGCAATTGG - Intronic
1124674743 15:31674581-31674603 ACCCAGGGATGAAATGCAATTGG + Intronic
1126432490 15:48601137-48601159 GCCCAGGGTAGAAAGACCATGGG + Intronic
1127609558 15:60623446-60623468 ACCCAGGGCTGATATACCCTAGG + Intronic
1127848168 15:62889778-62889800 AGGCAGAGTTGAAATACCATTGG - Intergenic
1128727300 15:69997699-69997721 ACCCAGGGCTCGTATGCCATAGG + Intergenic
1128901983 15:71431730-71431752 ACCCAAGGCTTGTATACCATAGG + Intronic
1129381511 15:75170623-75170645 ACCAAGGGCTTATATACCATAGG - Intergenic
1130137153 15:81190820-81190842 ACCCAGGGTTTATATATCATAGG + Intronic
1130930179 15:88420662-88420684 ACCCAGGGCTTATATACCACAGG + Intergenic
1131229686 15:90650986-90651008 ACCCAGGGCATATATACCATAGG - Intergenic
1131751310 15:95510914-95510936 ACCCTGGGTTGATATAGGGTAGG - Intergenic
1133039366 16:3052221-3052243 ACACAGGGTTGAGATCCAATGGG + Intronic
1133043212 16:3071854-3071876 ACACAGGGTTGAGATCCAATGGG + Intronic
1133059766 16:3166861-3166883 ACCCAGGGTCTACATACCACAGG - Intergenic
1133557110 16:6916068-6916090 ACCCAGGGCTTATATACCTTAGG + Intronic
1135674764 16:24405944-24405966 ACCCAGAGCTTATATACCACAGG - Intergenic
1136000284 16:27287229-27287251 GACCAGGGCTTATATACCATAGG + Intronic
1136184093 16:28575117-28575139 CCCCAGGGCTTGTATACCATAGG - Intronic
1138161509 16:54759070-54759092 ACCCAGGATTGATATAGTAGGGG + Intergenic
1139370618 16:66467033-66467055 ACCCAGGGCTTATATATCACAGG + Intronic
1141099055 16:81183796-81183818 AACCAGGGCTTATATACCATAGG - Intergenic
1141276925 16:82596638-82596660 TCCCAGGGTTGATACTCCCTCGG - Intergenic
1141417176 16:83884738-83884760 ATCCAGGGCTTATACACCATAGG - Intergenic
1144271803 17:13624842-13624864 AGCCAGGGCTTATATACCACTGG + Intergenic
1144381955 17:14708355-14708377 AGCCAGGGCTTATATACCACAGG + Intergenic
1145000313 17:19300282-19300304 AGCCAGGGCTTATATGCCATAGG + Intronic
1148817176 17:50337359-50337381 ACCCAGGGCTTATCTACCACAGG - Intergenic
1148881585 17:50732047-50732069 ACCCAGGGCTTATATGCCATAGG + Intronic
1149149071 17:53537256-53537278 ACCCAGGGCTTCTAAACCATAGG - Intergenic
1149857364 17:60094580-60094602 ACCCAGGGCTGATATACCACAGG - Intergenic
1151206964 17:72514987-72515009 ACCCAGGGCTGAAATAACAGGGG - Intergenic
1154157097 18:11952173-11952195 ACCCAGGGTTTACACACCATCGG + Intergenic
1155376397 18:25163128-25163150 AACCAAGGTTTATATACCGTAGG + Intronic
1155825527 18:30437621-30437643 ACCCAGGTCTTATATACCATAGG + Intergenic
1156972366 18:43171469-43171491 ACCCAGGGCTCACATACCAAGGG - Intergenic
1158038883 18:53069045-53069067 ACCGAGGGCTTATATACCATGGG + Intronic
1159054019 18:63447559-63447581 ACCCAGGGCTTATATACCATAGG - Intergenic
1159823417 18:73175376-73175398 AGCCAGGGTTTATATCCCAAGGG - Intronic
1160344425 18:78121189-78121211 ACCCAGGGCTCATACGCCATAGG + Intergenic
1161584761 19:5099365-5099387 ACCCAGGGCTTATATACCATAGG + Intronic
1162159914 19:8704197-8704219 ACCCAAGGCTTATATACCATAGG + Intergenic
1167673105 19:50867132-50867154 ACCCAGGGCTTATATGCCATAGG - Intronic
926204315 2:10824372-10824394 ACCCAGGGTTGCTACACAATGGG - Intronic
927275725 2:21260782-21260804 GCCCAGGGATGAGATACCCTAGG - Intergenic
931697951 2:64885843-64885865 GCCCAGGGCTTATATACCATAGG + Intergenic
935484146 2:103632101-103632123 ACCCAGGGCTTATACACCACAGG - Intergenic
935764743 2:106355341-106355363 ACTCAGGGCTTACATACCATAGG + Intergenic
936514203 2:113171581-113171603 ACCCAGGGCTCATATACCATAGG + Intronic
938798460 2:134738433-134738455 ATCCTGGGTTTATATACCCTGGG + Intergenic
939126168 2:138179983-138180005 ACCCAGGTTTGAAAAACAATGGG - Intergenic
940215336 2:151297734-151297756 ACCCAGGGCTTATATACCACAGG + Intergenic
940504762 2:154539133-154539155 AACCAGGGCTTATCTACCATAGG - Intergenic
940756003 2:157684183-157684205 ACCCAGGGCTTATATATAATAGG - Intergenic
941880641 2:170476862-170476884 ACCCAGTGCTTATATACCATAGG - Intronic
941985279 2:171504630-171504652 ACCCAGGGCTTATCTACCACAGG - Intergenic
942211391 2:173674636-173674658 ACCCAGGGCTTATATACCATAGG + Intergenic
942595633 2:177589465-177589487 ACCCAGAATAGATATACAATTGG + Intergenic
944079351 2:195769577-195769599 ACCCAGGGCTGATGCATCATAGG - Intronic
944083878 2:195821562-195821584 ACCCAGGGCTCATATATCACAGG + Intronic
944240119 2:197478142-197478164 TCCCAGGGCTTATATACCTTAGG + Intergenic
945090742 2:206173386-206173408 ACCCAGGGCTTATATACCTTAGG + Intergenic
945491965 2:210466549-210466571 ACCCAGGGCTTACATACCATAGG - Intronic
946387206 2:219391142-219391164 ACCCAGGGCTTACATACCATAGG - Intronic
947024278 2:225719055-225719077 ACCCAGTACTGATATACAATCGG - Intergenic
948689664 2:239694002-239694024 ACCCAGGGCTGGTGCACCATGGG - Intergenic
1170733140 20:18991082-18991104 ACCCAGGGCTTGTATGCCATAGG - Intergenic
1171379621 20:24724537-24724559 ACCCAGGGCTTATATACCATAGG - Intergenic
1173481832 20:43407387-43407409 ACCCAGGGCTTTTATACCATAGG + Intergenic
1174432777 20:50482740-50482762 ACCCAGGGCTTCTATACCATAGG - Intergenic
1175690566 20:61062927-61062949 ACACAGGGCTCATAGACCATAGG + Intergenic
1179414668 21:41188570-41188592 ACCCAGGGCTTACATACCATAGG + Intronic
1180255982 21:46627844-46627866 ACCCAGGGCTTATAGACCATAGG + Intergenic
1181363209 22:22354586-22354608 ACCAAGGGTTCCTATTCCATGGG + Intergenic
1182591350 22:31382980-31383002 ATCCAGGGTTGTTATACTTTTGG + Intergenic
1184916640 22:47573997-47574019 ACCCAGGGCTTAAATACCACAGG - Intergenic
949360878 3:3230973-3230995 ACCCAGGGCTTATACACCATAGG - Intergenic
951804827 3:26632560-26632582 ACCCAGGGTTTATATATGGTAGG + Intronic
952705096 3:36369229-36369251 ACCAAGGGCTTATATACCATAGG - Intergenic
953586975 3:44210506-44210528 AACCAGGGCTTATATACCAAAGG + Intergenic
959302543 3:104621430-104621452 ACCAATGGATGAGATACCATTGG + Intergenic
963289981 3:143477604-143477626 AGCCAGGGTTGATGTAACAATGG - Intronic
966533811 3:181008889-181008911 ACACAGGGTGTATATACCATAGG + Intergenic
969722759 4:8901712-8901734 ACCCAGGGGTTATATGCCACAGG - Intergenic
970759707 4:19469813-19469835 ACCCAGTGCTCTTATACCATAGG - Intergenic
971486960 4:27170447-27170469 ACCCGGGGCTTATGTACCATAGG - Intergenic
971696960 4:29917369-29917391 AACCAGAGTTGAAATAACATGGG + Intergenic
972930674 4:44068272-44068294 ACCCAGGGCTTACATACCATAGG + Intergenic
973073635 4:45896335-45896357 ATCCAGGGATTATATACTATAGG + Intergenic
973644387 4:52935571-52935593 ACCCAGGGTTTACATACCGTAGG - Intronic
974091377 4:57314918-57314940 ACCCAGGGCTTATATACCATAGG - Intergenic
974936069 4:68411025-68411047 AGTCAGGGTTTATTTACCATTGG - Intergenic
976735117 4:88301424-88301446 ACCCAGGGTTTATATACCAGAGG + Intergenic
977105089 4:92872767-92872789 ACCCAGGGCTTATATACCATAGG + Intronic
977293452 4:95187871-95187893 CCCCAGGGTTTATGTCCCATTGG - Intronic
977481983 4:97590390-97590412 ATCCAGGGCTTATATACTATAGG + Intronic
977715423 4:100177179-100177201 AACCAGGGTTTATTTACCTTAGG - Intergenic
979998916 4:127465841-127465863 ACCCAGGGCTTATATAGCATAGG - Intergenic
980845900 4:138324739-138324761 ATCCAGGGTTGGTATTACATTGG - Intergenic
981253487 4:142631971-142631993 ACCCAAGGGTTATATACCACAGG + Intronic
985681028 5:1255869-1255891 ACCCAGGGTTTATGCACCACAGG - Intronic
986993930 5:13584947-13584969 ACCCAGGGCTTGTATACCACAGG - Intergenic
989816325 5:45742124-45742146 ACCCAGGGATTATATACCATAGG + Intergenic
991948107 5:71920654-71920676 ATTCAGGGGTTATATACCATAGG - Intergenic
993022981 5:82614066-82614088 ACCTAGGGCTTATGTACCATAGG + Intergenic
993416173 5:87635396-87635418 AACCAGGGATTATATACCATAGG - Intergenic
993539049 5:89125324-89125346 ACCCATGGCTTATATACCATAGG + Intergenic
993652481 5:90538916-90538938 CCTCAGGGATAATATACCATAGG + Intronic
994133725 5:96261432-96261454 ATCCAGGGCTTATATACCATAGG + Intergenic
994578115 5:101607575-101607597 ACCCAGGACTTATATACCATAGG - Intergenic
994871748 5:105360435-105360457 ACCCTGGGCTTATATATCATAGG + Intergenic
996132365 5:119796895-119796917 ACCTAGGGCTTATATGCCATAGG + Intergenic
998425858 5:142028123-142028145 ACCCAAGGATTATATACTATGGG - Intergenic
999166908 5:149557245-149557267 ACCCAGGACTTATATACCACAGG + Intronic
999364879 5:151016262-151016284 GCCCAGGGCTTATATAGCATAGG - Intergenic
1001073060 5:168603688-168603710 CCCCAGGGATGCTAAACCATGGG + Intergenic
1001828656 5:174767084-174767106 ACCCAGGTTTGATGTACCCCAGG - Intergenic
1001918936 5:175585537-175585559 ACCCTGGGTTTATATACCCTGGG - Intergenic
1002631934 5:180588056-180588078 ACCCAGGGTTTGTATATCACAGG - Intergenic
1005877134 6:30019640-30019662 ACCCAGGGCTTATATACCACAGG - Intergenic
1007527472 6:42509129-42509151 AGCCTGGGTTGAGATAGCATGGG + Intergenic
1007843050 6:44732251-44732273 ACCCAGGGCTTATATACCACAGG + Intergenic
1008096789 6:47347158-47347180 ACCCAGGGCTTATATACCACAGG - Intergenic
1009862759 6:69356142-69356164 ACACAGGGTTTATATACCATAGG + Intronic
1011598583 6:89039494-89039516 ACCCAGGGCTTATGTACCATAGG + Intergenic
1012422761 6:99082709-99082731 GCACAGGGTTGATTTACCACTGG - Intergenic
1013017219 6:106170788-106170810 ACCCATGCTGGATATACAATGGG - Intergenic
1015164453 6:130187864-130187886 ACCCAGGATTGAGATACCTTGGG - Intronic
1015812065 6:137170727-137170749 ACCCAGGGCTTACATACCACCGG + Intronic
1016737939 6:147500734-147500756 ACCCAAGGCTTCTATACCATAGG + Intergenic
1018049820 6:159999167-159999189 ACCCAGGGATCATACACCATAGG + Intronic
1018312961 6:162529680-162529702 ACCCAGGGCTTATATACCCTAGG + Intronic
1020976571 7:15013917-15013939 ACTCAGGGCTTATATACTATAGG - Intergenic
1021209169 7:17823966-17823988 ACCCAGGGTGGATGCACAATAGG + Intronic
1021398597 7:20182600-20182622 GCCCAGGGTTTATATACAGTAGG - Intronic
1022735128 7:33069154-33069176 ACCCAAGGCTTATATACCAGTGG + Intergenic
1023754753 7:43406163-43406185 ACCCAGGGCTTATGTACCATAGG - Intronic
1026613756 7:71883769-71883791 ACCCAGCGATTATATACCACAGG - Intronic
1026639070 7:72108680-72108702 ACCCAGGACTTATATATCATAGG - Intronic
1027152986 7:75745995-75746017 ACCCAAGGCTTATATACCACAGG + Intergenic
1028925169 7:96349770-96349792 ACCCTGGGTTTATATACCCTGGG - Intergenic
1031117077 7:117680321-117680343 ACCCCGGGCTTATACACCATAGG - Intronic
1031397916 7:121294573-121294595 ACCCAGGGCTTATATGCCATTGG + Intronic
1034097304 7:148421660-148421682 ACCCAGGGCTTATCCACCATAGG + Intergenic
1034301186 7:150016731-150016753 ACCCAAGGCTTATATACCATAGG + Intergenic
1034601760 7:152264408-152264430 ACCAAGAGATGAAATACCATAGG + Intronic
1034804867 7:154080575-154080597 ACCCAAGGCTTATCTACCATAGG - Intronic
1036384683 8:8268910-8268932 ACCCAGGTGTGATATCACATGGG + Intergenic
1036507406 8:9367996-9368018 AACCAGGGCTTATATAGCATAGG + Intergenic
1037469307 8:19191733-19191755 ACCCAGGGCTTATATACCATGGG + Intergenic
1037559360 8:20058789-20058811 ACCCAGAGCTCATATACCATAGG + Intergenic
1039698335 8:39936574-39936596 ACCCAGGGCTTATATACCACAGG + Intronic
1041990034 8:63976439-63976461 GCCCAGGGCTGATATATCAGAGG + Intergenic
1042152714 8:65805663-65805685 AACCAGGGCTTATACACCATAGG - Intronic
1042198042 8:66250282-66250304 ACCCAGGATTTATATGCCACAGG - Intergenic
1042412780 8:68483451-68483473 ACCCAGGGCTTATATATCATAGG + Intronic
1043877349 8:85500757-85500779 ACCCAGGGCTTACATACCACAGG + Intergenic
1047383541 8:124386759-124386781 ACCCAGGGCTTATGTACCCTAGG + Intergenic
1049502036 8:142972051-142972073 AACCAGGGTTTACGTACCATAGG - Intergenic
1049581733 8:143414860-143414882 ACCCAGAGGTTATATACCATAGG + Intergenic
1051001036 9:12281801-12281823 ACTCAGGGCTTATATACCATGGG + Intergenic
1051096290 9:13469458-13469480 ATCTAGGGCTTATATACCATAGG + Intergenic
1055197236 9:73611210-73611232 ACCTAGGGCTTATATAACATAGG + Intergenic
1058143195 9:101380305-101380327 ACCCAGGGTTGATATACCATAGG - Intronic
1061990371 9:134155397-134155419 ACCCAGGGATGGTGCACCATGGG - Intronic
1186058125 X:5673165-5673187 ACCCAGGGCTTATATACCATAGG + Intergenic
1186730875 X:12408138-12408160 ACCCAGGGCTTATATACCATAGG + Intronic
1189736014 X:44070654-44070676 ACCCAGGGCTTATATACCATAGG + Intergenic
1189991152 X:46596416-46596438 ACCCAGGGATTATAAACCACAGG - Intronic
1190098336 X:47500780-47500802 ACTCAGGGCTTATATACCATAGG - Intergenic
1190230976 X:48581655-48581677 ACCCACGGCTTACATACCATAGG + Intergenic
1190412991 X:50155531-50155553 ACCCGGGGATTATATACCGTAGG + Intergenic
1195630273 X:107048702-107048724 ACCCAGAGTTTATATACAACAGG + Intergenic
1197209721 X:123818840-123818862 ACCTAGGGTTTATACACCATAGG - Intergenic
1201253661 Y:12086436-12086458 ACCCAGGGCTTATATACCATGGG - Intergenic