ID: 1058143202

View in Genome Browser
Species Human (GRCh38)
Location 9:101380325-101380347
Sequence GGTCTGGGGAGTAACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058143189_1058143202 22 Left 1058143189 9:101380280-101380302 CCTGCTGAAGCATGTATATCCTT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143195_1058143202 -3 Left 1058143195 9:101380305-101380327 CCTATGGTATATCAACCCTGGGT 0: 1
1: 2
2: 28
3: 79
4: 168
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143191_1058143202 3 Left 1058143191 9:101380299-101380321 CCTTTCCCTATGGTATATCAACC 0: 1
1: 3
2: 16
3: 64
4: 154
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data
1058143193_1058143202 -2 Left 1058143193 9:101380304-101380326 CCCTATGGTATATCAACCCTGGG 0: 1
1: 2
2: 24
3: 78
4: 171
Right 1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058143202 Original CRISPR GGTCTGGGGAGTAACAGTGA GGG Intronic
No off target data available for this crispr