ID: 1058144798

View in Genome Browser
Species Human (GRCh38)
Location 9:101399201-101399223
Sequence GACAACCGGGATCCCCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058144798_1058144806 -3 Left 1058144798 9:101399201-101399223 CCCCCCCGGGGATCCCGGTTGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1058144806 9:101399221-101399243 GTCTCGCCGCTACCCCAGCTAGG 0: 1
1: 0
2: 0
3: 5
4: 145
1058144798_1058144812 22 Left 1058144798 9:101399201-101399223 CCCCCCCGGGGATCCCGGTTGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1058144812 9:101399246-101399268 GCACCACTGCTTTCTCCCCCAGG 0: 1
1: 0
2: 1
3: 54
4: 925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058144798 Original CRISPR GACAACCGGGATCCCCGGGG GGG (reversed) Intronic
900529150 1:3144264-3144286 GACAACCTGGGTCCCTGGGAGGG + Intronic
902336851 1:15758948-15758970 GCCAGCCGGGACCCCCGGCGCGG + Intronic
903449386 1:23442554-23442576 GACAGGAGGGATCCCTGGGGAGG - Exonic
920392134 1:205613675-205613697 AACAACCAGGATCTCTGGGGTGG - Exonic
1069738331 10:70672262-70672284 GACGCCTGGGATCCCCGGAGTGG - Intergenic
1072809226 10:98446565-98446587 GGCAAACGGGAGCCCCGCGGCGG - Intronic
1077283746 11:1756887-1756909 GGGACCGGGGATCCCCGGGGAGG - Intronic
1084733245 11:71088176-71088198 GACAAACAGGATCCCCGCAGCGG + Intronic
1089572644 11:119420512-119420534 GAGAAGTGGGATCCCTGGGGTGG - Intronic
1092145642 12:6212798-6212820 GACAAGCTGGGTCCCTGGGGAGG - Intronic
1092521858 12:9283958-9283980 GACAAGCGGGAACCCCTGTGTGG + Intergenic
1092545424 12:9447898-9447920 GACAAGCGGGAACCCCTGTGTGG - Intergenic
1093561837 12:20551888-20551910 GCCCACGGGGATCCCCGGGATGG - Intronic
1094178345 12:27564862-27564884 GACCACCGGGGTCCTCGGTGAGG - Intronic
1094507528 12:31074153-31074175 GACAAGCGGGAACCCCTGTGTGG + Intronic
1103464800 12:121133385-121133407 AACACCCTGGATCCCCAGGGAGG + Intronic
1108733443 13:53258232-53258254 GACCACCAGGTTCCCCGAGGAGG + Intergenic
1113484882 13:110646455-110646477 GAGATCCGGGAGCCCCGGGCTGG - Intronic
1118898720 14:69968936-69968958 GACAACTGGGATCCCATGGAAGG - Intronic
1122038369 14:98964654-98964676 GATAACAGGGATCACGGGGGAGG - Intergenic
1122264045 14:100538514-100538536 GACCGCCCGGCTCCCCGGGGAGG - Exonic
1123197650 14:106631692-106631714 GACAGCTGGGAATCCCGGGGCGG + Intergenic
1126067865 15:44839707-44839729 GACACCCTGGGTCCCCAGGGAGG - Intergenic
1126091963 15:45060868-45060890 GACACCCTGGGTCCCCAGGGAGG + Intronic
1128886030 15:71289183-71289205 GTCAACAGGGAGCCCCAGGGTGG - Intronic
1129152793 15:73699600-73699622 GACAGCTGGGCTCCCCGTGGTGG - Exonic
1137061675 16:35796025-35796047 GAGAAGCAGGATCCCCTGGGAGG - Intergenic
1139544920 16:67645586-67645608 GAAAACCTGGCTACCCGGGGAGG + Exonic
1143621134 17:8080799-8080821 GGCAACTGGGATCCAGGGGGCGG + Exonic
1143830358 17:9645842-9645864 GGCCCCCGGGAGCCCCGGGGAGG + Exonic
1147796527 17:43047698-43047720 GACACCCTGGATCCCCAGGAAGG + Exonic
1150389413 17:64781731-64781753 GACAGCCAGGATCCCGGGAGTGG - Intergenic
1150686106 17:67322211-67322233 GACAAAAGGGATCCCCGGCCAGG + Intergenic
1152684589 17:81687836-81687858 GTCCACCGGGATCCCCGGGCAGG - Intronic
1155972231 18:32092904-32092926 GACAACCCGGCTCCGCGAGGGGG - Intronic
1161309290 19:3585362-3585384 GACTGCGGGTATCCCCGGGGAGG + Intergenic
1161556247 19:4944404-4944426 GCCCACGGGGATCCCCGGGATGG - Exonic
1162312063 19:9913694-9913716 GACACCCAGGCGCCCCGGGGGGG + Intronic
1162939061 19:13997213-13997235 CAGAACCTGGATCCCGGGGGAGG - Intronic
1163498049 19:17658116-17658138 GACTCCCGGGAGCCCAGGGGTGG + Exonic
1166354184 19:42217330-42217352 GTCAGCAGGGAGCCCCGGGGTGG - Intronic
1167304702 19:48700992-48701014 GACAACAGGGATGCCCTGAGGGG + Intronic
1168290972 19:55357414-55357436 GACCACGGGGATCCCGGGGTGGG - Intronic
925900886 2:8508748-8508770 CACACCCAGGAACCCCGGGGTGG + Intergenic
926081691 2:9992150-9992172 GGTAACCAGGATCCCAGGGGAGG + Intronic
946861216 2:224001784-224001806 GAAAACCTGGATCCCCGTGTTGG + Exonic
1175036281 20:56004228-56004250 GAGCACCGGGATCCCGGGGTAGG - Exonic
1182358532 22:29733682-29733704 GACAGTGGGGATCCCCAGGGAGG + Intronic
950031274 3:9855487-9855509 GACAGATGGGATCCCCGGGAGGG - Intergenic
953623929 3:44555150-44555172 GACTTCCGGGATCCCGGAGGGGG + Intergenic
961786488 3:129350107-129350129 GACAACCAGGGTCCTCAGGGTGG + Intergenic
969559727 4:7939466-7939488 GACGACCGGGACCCCCGCGCGGG + Exonic
979193387 4:117890844-117890866 GACAACTGTGATACCGGGGGTGG + Intergenic
985571896 5:651477-651499 GGCAACCTGGTTCCCCTGGGCGG + Intronic
985852002 5:2395386-2395408 GACAACTGGGCTCCCAAGGGTGG + Intergenic
1001271405 5:170314893-170314915 GACACCTGGGATCCCCAGGGTGG - Intergenic
1002174343 5:177393144-177393166 GACAAAGGGGCTCCCCAGGGAGG - Intronic
1006787573 6:36678816-36678838 GACAACAGGGGACCCCGGGCCGG + Exonic
1034099091 7:148436292-148436314 GACAGCCAGGATCCCAGGGCAGG + Intergenic
1034179327 7:149125809-149125831 GACCACCAGGTTCCCCAGGGAGG - Intronic
1039798773 8:40936794-40936816 CACAACTGGGACCCACGGGGAGG + Intergenic
1050083378 9:1938853-1938875 GGCAAGGTGGATCCCCGGGGTGG - Intergenic
1058144798 9:101399201-101399223 GACAACCGGGATCCCCGGGGGGG - Intronic
1059438304 9:114289243-114289265 GGCATCCGGGACCCCGGGGGTGG + Exonic
1061207610 9:129173906-129173928 TACCACAGGGATCCCTGGGGCGG + Intergenic
1062037142 9:134387393-134387415 GACCACGGGGAGCCTCGGGGAGG + Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1062453063 9:136623539-136623561 GACAGCAGGGATCTCTGGGGTGG + Intergenic
1192452049 X:71250804-71250826 AACAACAGGGATCCCAGGAGAGG - Intronic