ID: 1058150530

View in Genome Browser
Species Human (GRCh38)
Location 9:101459024-101459046
Sequence CTCACATGTGAAAGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058150525_1058150530 7 Left 1058150525 9:101458994-101459016 CCTAATGACAGTCTGATTGCCGT No data
Right 1058150530 9:101459024-101459046 CTCACATGTGAAAGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058150530 Original CRISPR CTCACATGTGAAAGGGAATG AGG Intergenic
No off target data available for this crispr