ID: 1058151391

View in Genome Browser
Species Human (GRCh38)
Location 9:101467355-101467377
Sequence AAAGGAATAAGGATGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058151391_1058151394 -7 Left 1058151391 9:101467355-101467377 CCTGTCTTCATCCTTATTCCTTT No data
Right 1058151394 9:101467371-101467393 TTCCTTTCTTGAAGAGTAAAGGG No data
1058151391_1058151393 -8 Left 1058151391 9:101467355-101467377 CCTGTCTTCATCCTTATTCCTTT No data
Right 1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG No data
1058151391_1058151396 26 Left 1058151391 9:101467355-101467377 CCTGTCTTCATCCTTATTCCTTT No data
Right 1058151396 9:101467404-101467426 CTCAAATCTCTAGAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058151391 Original CRISPR AAAGGAATAAGGATGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr