ID: 1058153316

View in Genome Browser
Species Human (GRCh38)
Location 9:101486082-101486104
Sequence TTGGGGCGTGAGCTCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153316_1058153324 22 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA No data
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153316_1058153322 13 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153316_1058153323 21 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA No data
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153316 Original CRISPR TTGGGGCGTGAGCTCCTGCA GGG (reversed) Intronic