ID: 1058153316

View in Genome Browser
Species Human (GRCh38)
Location 9:101486082-101486104
Sequence TTGGGGCGTGAGCTCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153316_1058153323 21 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153316_1058153322 13 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153316_1058153324 22 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153316 Original CRISPR TTGGGGCGTGAGCTCCTGCA GGG (reversed) Intronic
902399231 1:16148852-16148874 TGGTGGCGCCAGCTCCTGCAAGG - Exonic
902807823 1:18871996-18872018 GTGGTGGCTGAGCTCCTGCAGGG + Exonic
903473053 1:23600675-23600697 TTCTGGCCTGAGCGCCTGCAGGG - Intronic
906021043 1:42629887-42629909 TACGGGCGTGAGCCGCTGCATGG + Intronic
906657799 1:47561369-47561391 TTGGACTGTGAGCTCCTCCAAGG - Intergenic
906680367 1:47722155-47722177 TTCGGCTGTGAGCTCCTCCAGGG + Intergenic
914921439 1:151850225-151850247 GTGGTGCTGGAGCTCCTGCAAGG - Intronic
918381424 1:183959586-183959608 TTGGGATGTGAGCTCTAGCAAGG - Intronic
1063887750 10:10596648-10596670 TTCTGGGGTGAGCGCCTGCAGGG + Intergenic
1067167059 10:43873784-43873806 CTGGGGCTGGAGCTCCTGGATGG - Intergenic
1075520845 10:123142764-123142786 GTGGGGCCTGAGCTTCTGCTGGG + Intergenic
1075911530 10:126129293-126129315 CTGGAGCATGAGCTCCTGGAGGG - Intronic
1076787809 10:132759756-132759778 ATGGGGCCGGGGCTCCTGCAGGG - Intronic
1078071156 11:8111908-8111930 CTGGTGTGTGAGCTCCAGCACGG - Intronic
1083744474 11:64727484-64727506 TTGGGCTGTGAGGTCATGCAGGG - Intronic
1084502811 11:69544864-69544886 TTGGGGTCTGAGCACCTGCCAGG + Intergenic
1084733458 11:71089322-71089344 TCAGGGCGTGAGCGTCTGCATGG + Intronic
1090118258 11:123997605-123997627 TTAGGCTGTGAGCTCCTACAGGG + Intergenic
1091699606 12:2651087-2651109 CTGGGGCATGAGGTCCTTCAGGG + Intronic
1095516662 12:43013685-43013707 TTAGGGTGTGAGCTCCTTGAGGG + Intergenic
1098522221 12:71446022-71446044 TTTGGCTGTGAGCTCCTCCAGGG + Intronic
1098934547 12:76463305-76463327 TTGGGGTTTGAGCACCTGGAAGG + Intronic
1100424709 12:94473559-94473581 TTGGGAGTTGAGATCCTGCATGG + Intergenic
1102626941 12:114242688-114242710 TTGGGGCTTAAGCTCCTGTTAGG + Intergenic
1103556061 12:121767132-121767154 AAAGGCCGTGAGCTCCTGCAAGG + Intronic
1103608853 12:122108671-122108693 TTAGTCCGTGAGCTCCTGCAAGG + Intronic
1103811634 12:123618673-123618695 CTGGGGCTTCATCTCCTGCAGGG - Exonic
1103947996 12:124537751-124537773 TTGGGGCCTGAGGGCCTGCCAGG - Intronic
1105258705 13:18762861-18762883 TTGGGGCGTGAGCTGTTGATAGG - Intergenic
1112205008 13:97316162-97316184 TTTGGGCCTGAGCCCCTGGAAGG - Intronic
1113833289 13:113313582-113313604 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833352 13:113313822-113313844 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833391 13:113313966-113313988 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833417 13:113314062-113314084 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833456 13:113314206-113314228 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833482 13:113314302-113314324 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833524 13:113314446-113314468 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833549 13:113314542-113314564 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833574 13:113314638-113314660 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833599 13:113314734-113314756 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833673 13:113315021-113315043 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833697 13:113315117-113315139 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1113833724 13:113315213-113315235 CTGGGGCGTGGCCTCCTGGAGGG + Intronic
1115496690 14:34011989-34012011 TTGGGGAGTCAGCTCCTTGAGGG - Intronic
1122457074 14:101862506-101862528 ATTAGGGGTGAGCTCCTGCATGG - Intronic
1122837323 14:104436608-104436630 CTGTGGGGTGAGCTCCAGCATGG + Intergenic
1125749821 15:42020720-42020742 TTGGGGCCAGGGCTCCTGCTTGG - Intronic
1126113055 15:45186929-45186951 CTGGGGCTTCAGCACCTGCAAGG + Intronic
1128061129 15:64736671-64736693 GTGGGGCCTGCACTCCTGCAGGG + Intergenic
1128251202 15:66165547-66165569 TTGGGGCGAGAGCTGGGGCAGGG - Intronic
1129200863 15:73998391-73998413 TCGGTGCGTGAGTTCCTGGACGG + Exonic
1129690011 15:77707810-77707832 TTGGTGCCTGTGCTCCTGCCTGG - Intronic
1132539561 16:502269-502291 TTGGGGCAGGAGCTTCTCCAGGG - Intronic
1132929102 16:2449569-2449591 TTGGGGGGTGAGATACAGCACGG + Intronic
1135091505 16:19521779-19521801 CCGGGGCTTGAGCACCTGCAGGG + Exonic
1135133582 16:19871928-19871950 GTTGGGCGTGTTCTCCTGCAGGG + Exonic
1136179756 16:28542955-28542977 TTGGGGAGTTAGCTCCTGGTGGG + Intergenic
1138580342 16:57937035-57937057 CTGTGGCGTGTGCTTCTGCATGG - Intronic
1139379803 16:66523342-66523364 GTGGGGCGTCAGCTCCTGCCTGG - Intronic
1139506233 16:67399442-67399464 TTGGAGCGAGCGCTCCTGCAGGG + Exonic
1141116179 16:81311812-81311834 CTGGGTTGTGAGCTCCTCCAAGG - Intergenic
1142547431 17:714644-714666 CTCGGGCGTGAGCTGCAGCACGG + Exonic
1142985877 17:3695240-3695262 TTGTGGCGCCAGCTCCTGCCAGG + Intronic
1143610118 17:8013229-8013251 CTCGGGAGTGAGCTCCAGCATGG - Exonic
1143813711 17:9493638-9493660 TAGGGGCGTGGGCTCCTCCCTGG + Intronic
1146945100 17:36868335-36868357 TTGGGGCCTCAGATCCTGCAGGG - Intergenic
1147212557 17:38880369-38880391 TTGGGTGGAGGGCTCCTGCAGGG + Intronic
1147567086 17:41544393-41544415 TGAGGCTGTGAGCTCCTGCAGGG - Intergenic
1147669843 17:42170652-42170674 GTGGGAGGTGAGCTCCTGGAAGG + Intronic
1152064889 17:78105653-78105675 GTGTGGCGCGTGCTCCTGCACGG + Exonic
1156487794 18:37477581-37477603 TGGTGGTGTGGGCTCCTGCAGGG + Intronic
1157575801 18:48742250-48742272 GTGGGGTGGGAGTTCCTGCAGGG + Intronic
1158395673 18:57077103-57077125 CTGGAGAGTGAGCTGCTGCAGGG + Intergenic
1162931864 19:13961477-13961499 TTGGGGCGGGGGCTCCAGCTGGG - Intergenic
1164705281 19:30314862-30314884 GTGGTTCCTGAGCTCCTGCAGGG + Intronic
1164825023 19:31278581-31278603 GTGGGCAGTGAGCTCCTGCAGGG + Exonic
1165745882 19:38229365-38229387 TGGGGGCGGGAGCCCCTCCAGGG - Intronic
1165760166 19:38316228-38316250 TAGGGGCGTGAGCCCCGGCAAGG - Intronic
1167133638 19:47603734-47603756 TACGGGCGTGAGCCACTGCACGG + Intergenic
1167242229 19:48351235-48351257 TTTGGGCCTGAGCACCTGGAAGG - Intronic
925491203 2:4395389-4395411 TCCAGGCCTGAGCTCCTGCATGG - Intergenic
926089628 2:10041960-10041982 GTGGCTTGTGAGCTCCTGCAGGG - Intergenic
926348932 2:11977800-11977822 CTGCGGAGTAAGCTCCTGCATGG - Intergenic
930208223 2:48609466-48609488 TTGGGGCTTGAGAACATGCAGGG - Intronic
934676747 2:96254710-96254732 TTGGCACATGAGCTCCTGGAAGG + Intronic
935223780 2:101036377-101036399 CTGGGCTCTGAGCTCCTGCAGGG - Intronic
946109832 2:217405137-217405159 TATGGGCGTGTGCTCCTGCCTGG - Intronic
947667741 2:231917921-231917943 ATGGGGCAGGAGCTCCTGCAGGG - Intergenic
948339082 2:237234541-237234563 TTGGGGCCTGTGCTTCAGCAGGG + Intergenic
948674334 2:239588231-239588253 ATGGGGCGTGAGCTGCTTCCTGG + Intergenic
1170804974 20:19621676-19621698 ATGGGGCCTGAGATTCTGCATGG + Intronic
1171334512 20:24371233-24371255 TTGGTGCTTGAGGCCCTGCAGGG + Intergenic
1174398185 20:50260816-50260838 TTGGGGCCTGGCCTCCTCCAAGG + Intergenic
1174703222 20:52630310-52630332 GAAGAGCGTGAGCTCCTGCAAGG - Intergenic
1174726706 20:52870354-52870376 CTGTAGCGTGAGCTCCTGCCTGG - Intergenic
1174765978 20:53254630-53254652 GTGGGTGGTGAGCTGCTGCAAGG - Exonic
1175714850 20:61248374-61248396 TGGGGGCGTGTGCTTCTGGATGG + Intergenic
1176709172 21:10135087-10135109 TTGGGGCCTGGGATCCTACAGGG - Intergenic
1179452856 21:41477564-41477586 GTAGGGCCTGGGCTCCTGCAAGG - Intronic
1179979101 21:44887265-44887287 ATGGGGAGTGAACTCCAGCAGGG - Intronic
1183241346 22:36660154-36660176 CTAGGCCGTGAGCTCTTGCAGGG + Intronic
1183495771 22:38142966-38142988 TTGAGGCCTGAGCTCCTTCATGG - Intronic
1184343280 22:43897870-43897892 CTGTGGCGTCAGCTCCTGCGAGG - Intergenic
950453329 3:13078075-13078097 GTGCAGCGTGAGCTCCTGCAGGG - Intergenic
950641860 3:14353629-14353651 TTTGGCCCTGAGGTCCTGCAGGG + Intergenic
952728845 3:36618354-36618376 TTGGGGACAGACCTCCTGCATGG + Intergenic
955917788 3:63924183-63924205 TTGGGGCTTGAGCAACTGAATGG + Intronic
955996067 3:64682096-64682118 TAGGGGAGTGATGTCCTGCAAGG + Intronic
957620214 3:82584834-82584856 GTGGGGGGTCAGCTCCTGCCGGG + Intergenic
961459508 3:127041453-127041475 GTGGGGCAGGAGCTTCTGCAGGG - Intergenic
964326557 3:155553011-155553033 TTGGGGAGTAAGCTCCTTAATGG + Intronic
964624593 3:158747165-158747187 CTGGGGCTTGAGGTCCTGGAAGG + Intronic
964728299 3:159838003-159838025 TAGGGCAGTGAGCTTCTGCACGG + Intronic
968295949 3:197576824-197576846 TTGGGCTGTGAGCACCTGGATGG - Intergenic
968958974 4:3733282-3733304 CTGGCGGGTGGGCTCCTGCATGG + Intergenic
979107771 4:116709148-116709170 TTGGGGCATGAGCCACTGCATGG + Intergenic
981154000 4:141412630-141412652 TTGGGCCGGGTGGTCCTGCATGG + Intergenic
985865588 5:2511612-2511634 TTGTGGCGTCACCTCCTCCAGGG - Intergenic
986395843 5:7329291-7329313 TTGATGAGGGAGCTCCTGCAGGG + Intergenic
991391175 5:66144720-66144742 TTGGGGGGTTAACTACTGCACGG + Intronic
998170171 5:139868168-139868190 TTGGGGTGCTAGCTCCTTCAGGG + Intronic
1001483175 5:172102315-172102337 TTGGGGCCTGAGCCACTGGAAGG + Intronic
1002055379 5:176595524-176595546 TGGTGGCCTGTGCTCCTGCAGGG - Exonic
1004061861 6:12205500-12205522 GTGGGGCATGATCTACTGCACGG + Intergenic
1004284230 6:14305680-14305702 TTGGGGCCTGAGCTAATTCAGGG - Intergenic
1005481493 6:26259404-26259426 TTGGGGCTGCAGGTCCTGCAGGG - Intergenic
1006679169 6:35785082-35785104 TTGGGAAGTGAGCACATGCAGGG + Intronic
1010628893 6:78174057-78174079 TTGGGTGGTGAACTCCTTCATGG + Intergenic
1012038831 6:94177636-94177658 CTGGGGCGTAAGCTGATGCATGG + Intergenic
1017902972 6:158734317-158734339 TTGGAGTCTGAGCTCCTTCAAGG + Intronic
1018071820 6:160171358-160171380 TTGGGGCTTGAGCTCATGTCTGG + Intronic
1021623555 7:22571293-22571315 TTGGAGCGGGAGCTCTTGGAGGG + Intronic
1021763433 7:23923642-23923664 CTGGGGTGAGAACTCCTGCAGGG + Intergenic
1021962591 7:25887449-25887471 CTGGGGCCTGAGCTCAGGCATGG - Intergenic
1023659694 7:42459366-42459388 CTGGGGCCAGAGCTGCTGCATGG - Intergenic
1023851379 7:44152213-44152235 CTGGGCCCTGAGATCCTGCATGG + Intronic
1026518014 7:71089475-71089497 TTTGGGCGTGTCCTCTTGCAAGG - Intergenic
1030346819 7:108443244-108443266 TTGGATGGTGAGCTCCTCCAGGG - Intronic
1034573565 7:151978468-151978490 TAGGGGCCTGAGATTCTGCATGG - Intronic
1035589747 8:803259-803281 ATGGGGCGTGAGCTCCAGGCTGG - Intergenic
1037766232 8:21774134-21774156 GTGGGGGGTGAGCTCCTCTAGGG - Intronic
1037881441 8:22575276-22575298 TTGGGGCCAGAGCTCTTGCCAGG - Exonic
1042213179 8:66402206-66402228 TTGTGGCTAGCGCTCCTGCATGG + Intergenic
1042651552 8:71047682-71047704 TGGGCCTGTGAGCTCCTGCAGGG + Intergenic
1044817433 8:96127376-96127398 TGGGGGCATGGGCTCCGGCATGG - Intergenic
1045507792 8:102790928-102790950 TTGGGGGTAGAGCTCCTCCAGGG + Intergenic
1046897421 8:119487869-119487891 TTTGGGAGTGAGCTCCAGGAAGG - Intergenic
1049390003 8:142362942-142362964 TTGGGCTTTGAGCTCCTGCCTGG - Intronic
1053415251 9:37943356-37943378 TGAGGCTGTGAGCTCCTGCAGGG + Intronic
1053646143 9:40120615-40120637 TTGGGGCCTGGGATCCTACAGGG - Intergenic
1053759572 9:41342925-41342947 TTGGGGCCTGGGATCCTACAGGG + Intergenic
1054327156 9:63718512-63718534 TTGGGGCCTGGGATCCTACAGGG - Intergenic
1054538427 9:66255361-66255383 TTGGGGCCTGGGATCCTACAGGG + Intergenic
1055013395 9:71591182-71591204 TTGGGGCCTGAGTTCCCCCAAGG - Intergenic
1055841538 9:80511319-80511341 TTGGGGCTTGAATACCTGCATGG + Intergenic
1057287707 9:93773561-93773583 TTAGTGAGTCAGCTCCTGCAGGG + Intergenic
1057637879 9:96787687-96787709 TTGGGGGCTGAGCTCCTTCCTGG + Intergenic
1058153316 9:101486082-101486104 TTGGGGCGTGAGCTCCTGCAGGG - Intronic
1058923398 9:109639791-109639813 TTAACCCGTGAGCTCCTGCAGGG + Intergenic
1060405114 9:123369133-123369155 CTGGGGCCTGAGCACCTGAAGGG + Intronic
1060434902 9:123584868-123584890 CTGGGGTGTGGGCTCCTTCAGGG + Intronic
1060555147 9:124504309-124504331 TTGGCGCTTGGGCTCCTGCCCGG - Intronic
1060993456 9:127862125-127862147 CTAGTGCGTGGGCTCCTGCATGG - Intergenic
1062228188 9:135465684-135465706 CTGGGCCGTGAGCCCCTGCCAGG - Intergenic
1202793933 9_KI270719v1_random:104057-104079 TTGGGGCCTGGGATCCTACAGGG - Intergenic
1190052169 X:47158379-47158401 GTGGGCCGTGAGCTCCAGCTGGG - Intronic