ID: 1058153317

View in Genome Browser
Species Human (GRCh38)
Location 9:101486083-101486105
Sequence CTTGGGGCGTGAGCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153317_1058153322 12 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153317_1058153323 20 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG No data
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153317_1058153324 21 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG No data
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153317 Original CRISPR CTTGGGGCGTGAGCTCCTGC AGG (reversed) Intronic