ID: 1058153317

View in Genome Browser
Species Human (GRCh38)
Location 9:101486083-101486105
Sequence CTTGGGGCGTGAGCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153317_1058153324 21 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG 0: 1
1: 0
2: 1
3: 31
4: 161
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153317_1058153322 12 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG 0: 1
1: 0
2: 1
3: 31
4: 161
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153317_1058153323 20 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG 0: 1
1: 0
2: 1
3: 31
4: 161
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153317 Original CRISPR CTTGGGGCGTGAGCTCCTGC AGG (reversed) Intronic
900126364 1:1070604-1070626 CATGGGGCGTGACTTCCTGGAGG + Intergenic
901055321 1:6446462-6446484 TTTAGGGCTTGAGCTCCTGGGGG + Intronic
902479043 1:16702127-16702149 TTTAGGGCTTGAGCTCCTGGGGG - Intergenic
902652252 1:17844541-17844563 CTTGGATCTGGAGCTCCTGCTGG + Intergenic
904031554 1:27536508-27536530 CTTGGGGCAAGGGCTGCTGCTGG + Intronic
904080527 1:27869581-27869603 CTTGGGCCGTGACCACCTGCAGG + Intergenic
907857391 1:58317296-58317318 CTTAGGGCGTGAGATCTTGAGGG - Intronic
908955291 1:69618140-69618162 CTTGGAGCCAGAGTTCCTGCGGG - Intronic
914050539 1:144126716-144126738 GTCGGGGTGTGAGCTGCTGCTGG - Intergenic
914128643 1:144838729-144838751 GTCGGGGTGTGAGCTGCTGCTGG + Intergenic
920539987 1:206770993-206771015 CTTGGGGCATCACCTCCTCCAGG + Exonic
1063887749 10:10596647-10596669 CTTCTGGGGTGAGCGCCTGCAGG + Intergenic
1064790986 10:18958036-18958058 CTTGGGTCCAGAGCACCTGCTGG - Intergenic
1066622566 10:37374092-37374114 CTTGGGGCCTCAGCCCCTGCTGG + Intronic
1070518635 10:77231662-77231684 ATTGGGGTGTGAGCACATGCTGG - Intronic
1070776748 10:79114142-79114164 CCTGGGGAGCCAGCTCCTGCCGG - Intronic
1075046025 10:119147256-119147278 CCTCGGGTCTGAGCTCCTGCAGG + Intronic
1075074225 10:119339954-119339976 CTAGGGGCATGAGCTACTGTTGG + Intronic
1075443630 10:122498846-122498868 CTTGGGGCTTTAGCTCAGGCTGG + Intronic
1075520844 10:123142763-123142785 CGTGGGGCCTGAGCTTCTGCTGG + Intergenic
1076165704 10:128280962-128280984 CTCGGGAGGTGAGTTCCTGCTGG + Intergenic
1076787810 10:132759757-132759779 CATGGGGCCGGGGCTCCTGCAGG - Intronic
1077060981 11:617755-617777 CTTGGGGCTGGGGCTCCTGCAGG + Exonic
1077362283 11:2146002-2146024 CTTGGGGCTAAAGTTCCTGCCGG - Intronic
1078346050 11:10549542-10549564 CTTGGGGCAAGATCTCTTGCAGG + Intergenic
1078501676 11:11885540-11885562 CTGGTGGCGTGGGCTCCTGAGGG - Intronic
1079309036 11:19348139-19348161 CTTGGGGCGTGTGCGCCGGCTGG + Intergenic
1079550005 11:21683727-21683749 TTTGGGGAGTTAGCTCCTCCAGG + Intergenic
1080994449 11:37582090-37582112 CTTGGGGGATGAGGTCCTGGAGG + Intergenic
1081907137 11:46677355-46677377 CCTGGGGCCTGGGCTGCTGCTGG - Exonic
1083254752 11:61489258-61489280 GTTGTGTCCTGAGCTCCTGCTGG + Intronic
1083266082 11:61547426-61547448 CTTCGTGGGTCAGCTCCTGCGGG + Intronic
1089740524 11:120578956-120578978 GTTGAGGCGGGAGTTCCTGCAGG + Intronic
1092920636 12:13228699-13228721 CTTGTGTCCTGAGCTGCTGCAGG - Intergenic
1096120920 12:49089098-49089120 ATAGGGGCCTGAGCCCCTGCTGG + Intergenic
1098522220 12:71446021-71446043 CTTTGGCTGTGAGCTCCTCCAGG + Intronic
1098818507 12:75199897-75199919 CTTGGGAGGTAAGCTCCTGCAGG + Intronic
1102338827 12:112105631-112105653 CTTGGGGCCTCAGCTCTTGCTGG - Intronic
1104270474 12:127278454-127278476 ATTGGGGCTGGATCTCCTGCAGG + Intergenic
1105261374 13:18782165-18782187 CTTGGGGTGTGAGCTGTTGATGG - Intergenic
1106406495 13:29479412-29479434 CTTGGAGAGTGAGCTCAGGCAGG + Intronic
1108269917 13:48749292-48749314 CTTGTGGGATGAGCTCATGCTGG + Intergenic
1113833288 13:113313581-113313603 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833351 13:113313821-113313843 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833390 13:113313965-113313987 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833416 13:113314061-113314083 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833455 13:113314205-113314227 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833481 13:113314301-113314323 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833523 13:113314445-113314467 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833548 13:113314541-113314563 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833573 13:113314637-113314659 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833598 13:113314733-113314755 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833623 13:113314829-113314851 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833660 13:113314973-113314995 CCTGGGGCGTGGCCTCCTGAGGG + Intronic
1113833672 13:113315020-113315042 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833696 13:113315116-113315138 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113833723 13:113315212-113315234 CCTGGGGCGTGGCCTCCTGGAGG + Intronic
1113895784 13:113763959-113763981 CTTGGGCCGTGTGTTCCGGCTGG + Intronic
1114252238 14:20971428-20971450 CTGGGGGAGTGAGCGCGTGCGGG - Intergenic
1115496691 14:34011990-34012012 CTTGGGGAGTCAGCTCCTTGAGG - Intronic
1115581865 14:34767934-34767956 ATTGGGCCTTGAGCTACTGCTGG - Intronic
1121120853 14:91375111-91375133 CTTGGGCTGTGGGCTCCTGAGGG + Intronic
1123420412 15:20126026-20126048 ATCGGGGTGTGAGCTGCTGCTGG - Intergenic
1123445445 15:20327498-20327520 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1123529636 15:21132562-21132584 ATCGGGGTGTGAGCTGCTGCTGG - Intergenic
1124453568 15:29821597-29821619 CTTGGGGTGCCACCTCCTGCTGG - Intronic
1125749572 15:42019501-42019523 CCTGGGGAGGGAGTTCCTGCAGG - Intronic
1127547781 15:60005942-60005964 GAGGGGGCGTGGGCTCCTGCGGG - Exonic
1127646561 15:60964652-60964674 CTTGGGGTGAGATGTCCTGCTGG + Intronic
1128251203 15:66165548-66165570 CTTGGGGCGAGAGCTGGGGCAGG - Intronic
1128709660 15:69862117-69862139 CCTGGGGGTTGAGCTTCTGCAGG + Intergenic
1130432127 15:83859339-83859361 CCTTGGGCGTGATCTCCTCCAGG + Intronic
1132539562 16:502270-502292 CTTGGGGCAGGAGCTTCTCCAGG - Intronic
1132606549 16:796030-796052 CATCGGGCGTGCGCTCCTGGCGG - Exonic
1135091503 16:19521778-19521800 CCCGGGGCTTGAGCACCTGCAGG + Exonic
1136179755 16:28542954-28542976 TTTGGGGAGTTAGCTCCTGGTGG + Intergenic
1136721303 16:32321100-32321122 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1136839686 16:33527386-33527408 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1137398568 16:48134614-48134636 CTTTGGGCGTGACCTCCTCCAGG - Intronic
1137722178 16:50633646-50633668 CCTGGGGCGGGAGCACCTGCGGG + Exonic
1137964213 16:52914667-52914689 CTAGGGGTTTGAGCTGCTGCGGG + Intergenic
1138882387 16:61031479-61031501 CTGGTGGCGTGGGCTCCTGAGGG + Intergenic
1139506232 16:67399441-67399463 CTTGGAGCGAGCGCTCCTGCAGG + Exonic
1203005129 16_KI270728v1_random:196670-196692 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1203136679 16_KI270728v1_random:1732791-1732813 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1203149852 16_KI270728v1_random:1827671-1827693 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1144239246 17:13293927-13293949 CTTGTGGCGTGATTTCCTTCAGG - Intergenic
1145059042 17:19720833-19720855 CTTGAGGGCTCAGCTCCTGCAGG + Intergenic
1145940379 17:28740503-28740525 CTGGGGGCATGGGCACCTGCTGG - Exonic
1146798128 17:35797381-35797403 CTTGGGGAGGGAGCTTCTGAAGG - Intronic
1146945101 17:36868336-36868358 CTTGGGGCCTCAGATCCTGCAGG - Intergenic
1147567087 17:41544394-41544416 CTGAGGCTGTGAGCTCCTGCAGG - Intergenic
1148343850 17:46890434-46890456 CTCGGGGCCTGAGCTCCTGATGG - Intergenic
1148877250 17:50697029-50697051 CTTGGTAGGTGAGCTCCTGTCGG + Exonic
1148996156 17:51711815-51711837 CATGGGCCGTGGGCTTCTGCTGG + Intronic
1151308585 17:73279816-73279838 CCTCGGGCCTGTGCTCCTGCTGG - Intergenic
1154501342 18:14999361-14999383 CCTGGGGCTTGCGGTCCTGCGGG - Intergenic
1156868638 18:41917415-41917437 CTGGGGGTGTGGCCTCCTGCAGG + Intergenic
1158395672 18:57077102-57077124 CCTGGAGAGTGAGCTGCTGCAGG + Intergenic
1160735324 19:659660-659682 CCTGTGGCCTGAGCTCCAGCTGG + Intronic
1160809645 19:1007849-1007871 CTTGGGGGGGTCGCTCCTGCTGG - Exonic
1162782504 19:13013562-13013584 CTTGGGGCGGGGGGTGCTGCTGG - Intronic
1162931865 19:13961478-13961500 CTTGGGGCGGGGGCTCCAGCTGG - Intergenic
1162936056 19:13982123-13982145 CTGGGGGCGAGTGCACCTGCTGG + Exonic
1163103874 19:15112435-15112457 CTTCGGGCCTGTGCTGCTGCCGG + Exonic
1164825022 19:31278580-31278602 TGTGGGCAGTGAGCTCCTGCAGG + Exonic
1166371214 19:42302310-42302332 CTTGGCGCCGCAGCTCCTGCAGG + Exonic
1168315969 19:55484947-55484969 CGTGGGGCGGGAGCTCGCGCTGG + Intergenic
1202689946 1_KI270712v1_random:79354-79376 GTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1202713084 1_KI270714v1_random:28034-28056 TTTAGGGCTTGAGCTCCTGGGGG - Intergenic
929134800 2:38613512-38613534 CTTGGTGAGTGAGCTCCTGGGGG - Intergenic
930208224 2:48609467-48609489 CTTGGGGCTTGAGAACATGCAGG - Intronic
930232896 2:48860607-48860629 ACTGGGGGCTGAGCTCCTGCTGG - Intergenic
933956471 2:87376669-87376691 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
934240618 2:90268695-90268717 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
934272574 2:91548064-91548086 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
935222274 2:101025805-101025827 CTTGGTGCGTAAGCTACTCCTGG - Intronic
936148628 2:109997976-109997998 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
936196050 2:110373392-110373414 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
938186922 2:129240100-129240122 CTTGGAGCCAGAGCTTCTGCTGG - Intergenic
938448512 2:131395298-131395320 CTCGGGGCGTGGGCACCTCCAGG + Intergenic
939240213 2:139548380-139548402 TTTGGGGTGTCAGGTCCTGCAGG + Intergenic
944557063 2:200897854-200897876 CTAAGTACGTGAGCTCCTGCTGG + Intronic
946131962 2:217613382-217613404 CTTGGGGTGTGAGCCCCGGAGGG - Intronic
947667742 2:231917922-231917944 CATGGGGCAGGAGCTCCTGCAGG - Intergenic
948129893 2:235592523-235592545 CTTGTGGCATGAGCTCTTGGAGG + Intronic
948386560 2:237584345-237584367 CTTTGGGCGCTGGCTCCTGCAGG + Intronic
948636322 2:239340109-239340131 GTTGGGGCATGGGGTCCTGCTGG + Intronic
948642109 2:239382125-239382147 CTTGGGAAGGCAGCTCCTGCTGG - Intronic
1170467895 20:16639522-16639544 CCTGTGGCGTGACCTCCTCCAGG + Intergenic
1171334511 20:24371232-24371254 CTTGGTGCTTGAGGCCCTGCAGG + Intergenic
1173190121 20:40869724-40869746 CTTGGGCCTAGGGCTCCTGCCGG - Intergenic
1173816922 20:45995506-45995528 CCTAGTGTGTGAGCTCCTGCAGG + Intergenic
1176709173 21:10135088-10135110 CTTGGGGCCTGGGATCCTACAGG - Intergenic
1179189960 21:39115305-39115327 CTTGGGATGGGACCTCCTGCTGG + Intergenic
1180868849 22:19134794-19134816 CTTTAGGCGTGTGGTCCTGCTGG - Intronic
1181352531 22:22268715-22268737 CTTGGGGTGTGAGCTGCTGCTGG - Intergenic
1182552480 22:31107626-31107648 CTGGGGGCGTGGTCTCCAGCGGG - Intronic
1184913053 22:47549016-47549038 CTGGGGGCCTGAGCTCCTGGGGG + Intergenic
950038285 3:9902821-9902843 GCTGGGGCGAGGGCTCCTGCTGG + Exonic
950453330 3:13078076-13078098 CGTGCAGCGTGAGCTCCTGCAGG - Intergenic
950519486 3:13488174-13488196 CTAGGGGAGTGAGCTCCTCTTGG + Intronic
953418041 3:42734171-42734193 CTGGTGGCCTGACCTCCTGCTGG - Intronic
954810318 3:53243417-53243439 CTGGCGGCGTGAGCTCCAGATGG - Intronic
956111982 3:65878977-65878999 CCTGCTGCCTGAGCTCCTGCTGG + Intronic
957620213 3:82584833-82584855 GGTGGGGGGTCAGCTCCTGCCGG + Intergenic
961362320 3:126375856-126375878 CTGGCGGTGTGGGCTCCTGCAGG + Intergenic
968187908 3:196645997-196646019 GTGGGGGCGTGTCCTCCTGCAGG + Intronic
968609662 4:1551251-1551273 CCTGGGGCCTGAGCACCTGTGGG - Intergenic
968679269 4:1905480-1905502 CTGGAGGCCTGAGCTCCTGTGGG + Intronic
968760224 4:2438996-2439018 TCAGGGGCGTGGGCTCCTGCAGG - Intronic
969845920 4:9919927-9919949 TCTGGGGCTTGAGCTGCTGCAGG - Intronic
971334981 4:25714201-25714223 CATGGGGCTTCAGCTACTGCAGG - Intergenic
975739200 4:77412238-77412260 CTTGGTGCCTGGGCTCATGCTGG + Intronic
985865589 5:2511613-2511635 CTTGTGGCGTCACCTCCTCCAGG - Intergenic
986747615 5:10758515-10758537 CTTACGGGGTGAGCTCTTGCGGG - Intronic
1002455153 5:179341997-179342019 CTTGGAGAGTGTGCTCCTGGGGG - Intronic
1006410653 6:33871415-33871437 CTAGGGGCGAGAGCTCCTTTTGG - Intergenic
1006606810 6:35263351-35263373 CTTTGGGTGTCAGCTTCTGCAGG + Intronic
1006679168 6:35785081-35785103 CTTGGGAAGTGAGCACATGCAGG + Intronic
1013083413 6:106832937-106832959 CTTGGGGCATGAGCTTCAACTGG - Intergenic
1013455758 6:110328121-110328143 CTTTGTTCCTGAGCTCCTGCAGG + Intronic
1013793642 6:113860279-113860301 CCTGGGGCTTGGCCTCCTGCGGG - Exonic
1015905866 6:138115749-138115771 ATTGGGCCGTGAGCTCCTTGAGG + Intergenic
1024427194 7:49239885-49239907 GATGGGGAGGGAGCTCCTGCTGG + Intergenic
1024586784 7:50849228-50849250 CTCGAGGCTTGGGCTCCTGCAGG + Intergenic
1025950304 7:66140115-66140137 CTTGAGTTGTGAGCTCCTCCTGG + Intronic
1026586516 7:71660302-71660324 CTTGGAGCGTGCCCTCCTCCTGG + Intronic
1027162561 7:75813317-75813339 CTTGAGGCATGTGCTCCTGCTGG + Exonic
1030346820 7:108443245-108443267 CTTGGATGGTGAGCTCCTCCAGG - Intronic
1034355122 7:150445258-150445280 CCTGGGCCTGGAGCTCCTGCAGG + Intergenic
1035097036 7:156364248-156364270 CTTGGGGGGTGGGCACCTCCAGG + Intergenic
1035255908 7:157627191-157627213 TCCGGGGCGTGAGCTCCTGGTGG + Intronic
1035590078 8:805951-805973 CTTGGTCTGTGAGTTCCTGCTGG + Intergenic
1042159523 8:65877977-65877999 CTTGGGTCCAGAGCACCTGCTGG + Intergenic
1044952794 8:97450035-97450057 CTTGGTGCAGGAGCTCCAGCAGG + Intergenic
1050639437 9:7651542-7651564 CTTGGTGAGGGATCTCCTGCTGG - Intergenic
1052998711 9:34565569-34565591 CTTGGGGGGTGCGGTGCTGCTGG + Intronic
1053314612 9:37040981-37041003 CTTGGGGTGTGTGTTCCTTCAGG - Intergenic
1053646144 9:40120616-40120638 CTTGGGGCCTGGGATCCTACAGG - Intergenic
1053759571 9:41342924-41342946 CTTGGGGCCTGGGATCCTACAGG + Intergenic
1054327157 9:63718513-63718535 CTTGGGGCCTGGGATCCTACAGG - Intergenic
1054538426 9:66255360-66255382 CTTGGGGCCTGGGATCCTACAGG + Intergenic
1055637925 9:78296502-78296524 CGTGGGTCCTGAGTTCCTGCAGG - Intergenic
1056309385 9:85323417-85323439 CTTGGGTCCAGAGCACCTGCTGG + Intergenic
1058153317 9:101486083-101486105 CTTGGGGCGTGAGCTCCTGCAGG - Intronic
1059176401 9:112173538-112173560 GTAGGGGCCTGAGCTCCTTCGGG + Intronic
1060404648 9:123367350-123367372 CTTTGAGGGTGAGCCCCTGCTGG + Exonic
1062440361 9:136566913-136566935 CTTGGGGCCTGAGTGGCTGCTGG - Intergenic
1202793934 9_KI270719v1_random:104058-104080 CTTGGGGCCTGGGATCCTACAGG - Intergenic
1187396082 X:18920794-18920816 CCTGGGGCCTGAGGTTCTGCAGG + Intronic
1189160623 X:38805132-38805154 CTGGGGGCGTGCGCTCCTCCAGG - Exonic
1190052170 X:47158380-47158402 TGTGGGCCGTGAGCTCCAGCTGG - Intronic
1200068416 X:153515947-153515969 CCTGGGGCGTGTGCTCCTCCGGG - Intergenic