ID: 1058153318

View in Genome Browser
Species Human (GRCh38)
Location 9:101486099-101486121
Sequence ACTGCGCTCGCGGTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153318_1058153326 16 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153318_1058153327 17 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data
1058153318_1058153324 5 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153318_1058153323 4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153318_1058153322 -4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153318 Original CRISPR ACTGCGCTCGCGGTGTCTTG GGG (reversed) Intronic