ID: 1058153318

View in Genome Browser
Species Human (GRCh38)
Location 9:101486099-101486121
Sequence ACTGCGCTCGCGGTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153318_1058153324 5 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153318_1058153326 16 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153318_1058153322 -4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153318_1058153327 17 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data
1058153318_1058153323 4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153318 Original CRISPR ACTGCGCTCGCGGTGTCTTG GGG (reversed) Intronic
904130925 1:28274563-28274585 ACTGCCCTCGTGGAATCTTGAGG - Intronic
904837841 1:33350213-33350235 ACTGAGCTCTCGGTGACTGGTGG - Intronic
1068693818 10:59944586-59944608 TCTGGGCCCGCGGTGTCTTCTGG - Intergenic
1073141306 10:101249980-101250002 CCTGCGCTGGCGGTGTCCTGAGG - Intergenic
1084394221 11:68898307-68898329 GCTGGGCTTGTGGTGTCTTGGGG + Intronic
1084543325 11:69800772-69800794 ACTGCGCTCGGCTTGTCTTAGGG - Intergenic
1092103991 12:5908000-5908022 ACTGCTCTCACGGTGCATTGTGG - Intronic
1094173675 12:27520941-27520963 ACTGGCCTCTGGGTGTCTTGGGG - Intergenic
1099973895 12:89526079-89526101 ACAGGGCTGGCGGTGTCTCGGGG - Exonic
1113711041 13:112465835-112465857 TCTCCGCTCGCGGGTTCTTGTGG - Intergenic
1113733140 13:112657041-112657063 ACTGAGCTCCAGGCGTCTTGAGG + Intronic
1148323867 17:46772178-46772200 TATGCGCTCGCGGCGTCTTCCGG + Intronic
1165399043 19:35586046-35586068 GCTGCACTCTCTGTGTCTTGGGG + Intergenic
927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG + Intronic
932245250 2:70191081-70191103 CCTGAGCTCGCGTTGTCTTATGG + Intronic
933621375 2:84546180-84546202 ACTTGGCTCTCAGTGTCTTGGGG + Intronic
1176042404 20:63072442-63072464 ACTGCCCTTGCGGGGTCTCGGGG - Intergenic
1179481571 21:41681934-41681956 GCAGCCCTCGAGGTGTCTTGTGG - Intergenic
961997105 3:131257538-131257560 ATGGCCCTTGCGGTGTCTTGTGG + Intronic
972187020 4:36541777-36541799 ACTTGGCTCGCTGAGTCTTGGGG - Intergenic
984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG + Intronic
986181862 5:5400563-5400585 ACTGCTCTCTCAATGTCTTGGGG - Intergenic
1020977114 7:15020436-15020458 ACTGAGCTCCAGGTGACTTGAGG - Intergenic
1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG + Intergenic
1056249280 9:84731717-84731739 ACTGGGCTGCCGCTGTCTTGAGG - Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1060937549 9:127524441-127524463 ACTGCCCTCGGGGTGTTGTGTGG - Intronic
1062583904 9:137240512-137240534 ACTGCCCTCGCGGTCGCGTGAGG - Intergenic
1202367822 Y:24178977-24178999 GCTGTGCTTGCGGAGTCTTGTGG - Intergenic
1202502961 Y:25491146-25491168 GCTGTGCTTGCGGAGTCTTGTGG + Intergenic