ID: 1058153319

View in Genome Browser
Species Human (GRCh38)
Location 9:101486100-101486122
Sequence CACTGCGCTCGCGGTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153319_1058153327 16 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data
1058153319_1058153326 15 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153319_1058153322 -5 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153319_1058153323 3 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153319_1058153324 4 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153319 Original CRISPR CACTGCGCTCGCGGTGTCTT GGG (reversed) Intronic
900252515 1:1678501-1678523 CACTGAGCTGGCGGTGTGATGGG - Intronic
919578682 1:199343386-199343408 CAATGCACTCCCTGTGTCTTAGG + Intergenic
922881804 1:228986602-228986624 CACTGCGCTCTCAGTGTCACAGG - Intergenic
1084543326 11:69800773-69800795 CACTGCGCTCGGCTTGTCTTAGG - Intergenic
1091987067 12:4919228-4919250 CACTGCTGTTGGGGTGTCTTGGG - Intronic
1094173676 12:27520942-27520964 CACTGGCCTCTGGGTGTCTTGGG - Intergenic
1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG + Intronic
1107290967 13:38852778-38852800 CACTGCAGTCTCCGTGTCTTAGG + Intronic
1107411145 13:40159833-40159855 GACTGTGCTCTGGGTGTCTTTGG - Intergenic
1118299367 14:64601671-64601693 CGCTGCACTCGCTGGGTCTTGGG + Intergenic
1122126292 14:99580345-99580367 CACTGCACTCACGGTGACTCTGG - Intronic
1128513597 15:68328177-68328199 CACTGCGCTTGCAGTCTCTGTGG + Exonic
1141817925 16:86425503-86425525 CACTGCCCTGGAGGTGTCCTGGG - Intergenic
1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG + Intergenic
1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG + Intergenic
1168494563 19:56838618-56838640 CACCGCGCTCGCTGTGTTTTTGG - Intronic
925474555 2:4198423-4198445 CACTGCCCACGCTGTGTCTCAGG - Intergenic
927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG + Intronic
933621374 2:84546179-84546201 CACTTGGCTCTCAGTGTCTTGGG + Intronic
933728092 2:85437746-85437768 CGCTGCGCTCGCGGCTTCTGCGG - Intergenic
940977682 2:159964658-159964680 CACTGAGCTCACTGTGTCATAGG + Intronic
1176042405 20:63072443-63072465 CACTGCCCTTGCGGGGTCTCGGG - Intergenic
1183467102 22:37985303-37985325 CACTGGGCTCACCCTGTCTTGGG + Intronic
956780741 3:72601191-72601213 CACTGGGTTCGCAGAGTCTTAGG - Intergenic
958578536 3:95985853-95985875 GACTGTGTTCCCGGTGTCTTAGG + Intergenic
967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG + Intronic
985963964 5:3325445-3325467 GACGGCGCACACGGTGTCTTGGG + Intergenic
986181863 5:5400564-5400586 CACTGCTCTCTCAATGTCTTGGG - Intergenic
987618341 5:20305474-20305496 CGCTGCACTCGCTGGGTCTTGGG + Intronic
997554444 5:134783318-134783340 CACTGCGCTCACTGTGACCTCGG + Intronic
1003552286 6:7109306-7109328 CTCCCCGCTCGCGGTCTCTTAGG + Intronic
1005371650 6:25139952-25139974 CGCTGCACTCGCTGGGTCTTGGG - Intergenic
1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG + Exonic
1036140339 8:6201688-6201710 CTCTGCCCTCACGGAGTCTTGGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1060531010 9:124346992-124347014 CTCTGCACTCGCTGTGTCTCTGG - Intronic
1200000856 X:153059065-153059087 CACTGGGCTCCCGGGGCCTTAGG - Intronic