ID: 1058153320

View in Genome Browser
Species Human (GRCh38)
Location 9:101486101-101486123
Sequence GCACTGCGCTCGCGGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153320_1058153327 15 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data
1058153320_1058153330 30 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153330 9:101486154-101486176 AAAGAGGGCGAGACACACCCAGG No data
1058153320_1058153322 -6 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153320_1058153326 14 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153320_1058153323 2 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153320_1058153324 3 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153320 Original CRISPR GCACTGCGCTCGCGGTGTCT TGG (reversed) Intronic