ID: 1058153320

View in Genome Browser
Species Human (GRCh38)
Location 9:101486101-101486123
Sequence GCACTGCGCTCGCGGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153320_1058153326 14 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153320_1058153322 -6 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153320_1058153324 3 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153320_1058153330 30 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153330 9:101486154-101486176 AAAGAGGGCGAGACACACCCAGG No data
1058153320_1058153327 15 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data
1058153320_1058153323 2 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153320 Original CRISPR GCACTGCGCTCGCGGTGTCT TGG (reversed) Intronic
900252516 1:1678502-1678524 GCACTGAGCTGGCGGTGTGATGG - Intronic
900614601 1:3559629-3559651 GCTCTGCGCTTTCAGTGTCTGGG - Intronic
905867011 1:41382066-41382088 GCGCTGGGCTCGCGCTGTCCGGG + Exonic
918064509 1:181089969-181089991 GCTCAGCGCCCGCGGTCTCTGGG - Exonic
921642788 1:217575949-217575971 CCATTGCACTCACGGTGTCTTGG - Intronic
1063227630 10:4031132-4031154 GCAGTGCGATGGCGCTGTCTTGG - Intergenic
1069991151 10:72317018-72317040 TCACTGCTCTCGGGGTGCCTAGG - Intergenic
1072574423 10:96687203-96687225 GGACTGCGGTGGCGCTGTCTCGG - Intronic
1077178635 11:1202635-1202657 GCCCTGCGCTGGCCCTGTCTAGG - Intergenic
1093787329 12:23207693-23207715 GCACTGGGCTCGCCTTTTCTGGG + Intergenic
1113850246 13:113413699-113413721 GAGCTGCGCTGGCGGAGTCTGGG + Intergenic
1125732394 15:41900535-41900557 GCACTGCCCTCTCTGTGCCTTGG - Exonic
1132993813 16:2812293-2812315 GCACTGCGCCAGCGGTGAATTGG - Intergenic
1137708270 16:50549486-50549508 GCGCTGCCCGGGCGGTGTCTCGG + Exonic
1147208123 17:38853554-38853576 GCAGTGCTCTCGCGGTGGCCTGG + Intronic
1151848992 17:76678592-76678614 GCACTGAGCCCGTGGTGTGTGGG - Intronic
1152860837 17:82696526-82696548 GCACTGTGCCCTCGGGGTCTGGG - Intronic
1165485008 19:36090227-36090249 GCACTGAGCTTGCAGTGTGTGGG + Intronic
925161734 2:1689048-1689070 GCACTGGGCTCTCGGTCGCTGGG - Intronic
926090054 2:10043740-10043762 TCACTGCGCGCGCGTCGTCTGGG - Exonic
927812235 2:26186510-26186532 GCACTGCTGTCTGGGTGTCTTGG + Intronic
935196817 2:100820863-100820885 GCCCTGGGCCCGCGGTCTCTCGG + Intronic
1176042406 20:63072444-63072466 GCACTGCCCTTGCGGGGTCTCGG - Intergenic
966256130 3:177918032-177918054 GCTCTGCTCTCGCTGAGTCTGGG - Intergenic
985720293 5:1485346-1485368 GCACAGTGCTGGCGGGGTCTGGG - Intronic
1036140340 8:6201689-6201711 GCTCTGCCCTCACGGAGTCTTGG - Intergenic
1058153320 9:101486101-101486123 GCACTGCGCTCGCGGTGTCTTGG - Intronic
1192034119 X:67545269-67545291 GTGCTGCGCTCGCGGCCTCTGGG - Exonic
1201761544 Y:17544997-17545019 GCACTGCCCTCACAGAGTCTGGG + Intergenic
1201840008 Y:18360993-18361015 GCACTGCCCTCACAGAGTCTGGG - Intergenic