ID: 1058153321

View in Genome Browser
Species Human (GRCh38)
Location 9:101486109-101486131
Sequence CTAGTGTCGCACTGCGCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153321_1058153330 22 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153330 9:101486154-101486176 AAAGAGGGCGAGACACACCCAGG No data
1058153321_1058153323 -6 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153321_1058153324 -5 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153324 9:101486127-101486149 ACTAGCGACGCCGGAGCCAAGGG No data
1058153321_1058153331 25 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153331 9:101486157-101486179 GAGGGCGAGACACACCCAGGTGG No data
1058153321_1058153326 6 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153321_1058153327 7 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153321 Original CRISPR CTAGTGTCGCACTGCGCTCG CGG (reversed) Intronic
1072170018 10:92849261-92849283 CTAGGGTGACCCTGCGCTCGCGG + Intronic
1079184278 11:18221937-18221959 CAAGTGTCACACTGCTCTCCAGG + Intronic
1097854835 12:64451832-64451854 CTACTGTCGGCCAGCGCTCGGGG + Intergenic
1109725933 13:66341836-66341858 CTTGTGTCTCACTGCGCTCAAGG + Intronic
1114219464 14:20683760-20683782 CTTGTGTCTCACTGAGCCCGGGG - Intergenic
1124239839 15:28019989-28020011 CTGGTGACCCACTGCGCTGGAGG + Intronic
1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG + Intronic
944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG + Intronic
987211430 5:15687594-15687616 CTGGTGTAGCACTGCCCTCAAGG + Intronic
1032859546 7:135864178-135864200 CCAGTGTCACACTGCACTCAGGG - Intergenic
1050721894 9:8600363-8600385 CTAGTGCTGCACTGGGCTCACGG + Intronic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic