ID: 1058153322

View in Genome Browser
Species Human (GRCh38)
Location 9:101486118-101486140
Sequence CAGTGCGACACTAGCGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153318_1058153322 -4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153317_1058153322 12 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153320_1058153322 -6 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153316_1058153322 13 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data
1058153319_1058153322 -5 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG No data
Right 1058153322 9:101486118-101486140 CAGTGCGACACTAGCGACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153322 Original CRISPR CAGTGCGACACTAGCGACGC CGG Intronic