ID: 1058153323

View in Genome Browser
Species Human (GRCh38)
Location 9:101486126-101486148
Sequence CACTAGCGACGCCGGAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153319_1058153323 3 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153320_1058153323 2 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153317_1058153323 20 Left 1058153317 9:101486083-101486105 CCTGCAGGAGCTCACGCCCCAAG 0: 1
1: 0
2: 1
3: 31
4: 161
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153316_1058153323 21 Left 1058153316 9:101486082-101486104 CCCTGCAGGAGCTCACGCCCCAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153318_1058153323 4 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data
1058153321_1058153323 -6 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153323 9:101486126-101486148 CACTAGCGACGCCGGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153323 Original CRISPR CACTAGCGACGCCGGAGCCA AGG Intronic
No off target data available for this crispr