ID: 1058153326

View in Genome Browser
Species Human (GRCh38)
Location 9:101486138-101486160
Sequence CGGAGCCAAGGGCCAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153321_1058153326 6 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153318_1058153326 16 Left 1058153318 9:101486099-101486121 CCCCAAGACACCGCGAGCGCAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153319_1058153326 15 Left 1058153319 9:101486100-101486122 CCCAAGACACCGCGAGCGCAGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data
1058153320_1058153326 14 Left 1058153320 9:101486101-101486123 CCAAGACACCGCGAGCGCAGTGC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1058153326 9:101486138-101486160 CGGAGCCAAGGGCCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153326 Original CRISPR CGGAGCCAAGGGCCAGAAAG AGG Intronic
No off target data available for this crispr