ID: 1058153331

View in Genome Browser
Species Human (GRCh38)
Location 9:101486157-101486179
Sequence GAGGGCGAGACACACCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058153325_1058153331 -3 Left 1058153325 9:101486137-101486159 CCGGAGCCAAGGGCCAGAAAGAG 0: 1
1: 0
2: 2
3: 21
4: 300
Right 1058153331 9:101486157-101486179 GAGGGCGAGACACACCCAGGTGG No data
1058153321_1058153331 25 Left 1058153321 9:101486109-101486131 CCGCGAGCGCAGTGCGACACTAG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1058153331 9:101486157-101486179 GAGGGCGAGACACACCCAGGTGG No data
1058153328_1058153331 -9 Left 1058153328 9:101486143-101486165 CCAAGGGCCAGAAAGAGGGCGAG 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1058153331 9:101486157-101486179 GAGGGCGAGACACACCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058153331 Original CRISPR GAGGGCGAGACACACCCAGG TGG Intronic
No off target data available for this crispr