ID: 1058155379

View in Genome Browser
Species Human (GRCh38)
Location 9:101508913-101508935
Sequence AAACCCTGTTTCACAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058155377_1058155379 4 Left 1058155377 9:101508886-101508908 CCTCGTTTTATTTGCTGTCACTG No data
Right 1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058155379 Original CRISPR AAACCCTGTTTCACAAAGGT AGG Intronic