ID: 1058155740

View in Genome Browser
Species Human (GRCh38)
Location 9:101512743-101512765
Sequence ATTGATGAAAGCTATTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058155740_1058155747 16 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG No data
1058155740_1058155746 15 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155746 9:101512781-101512803 TTCCTCTCCGTGGATTTAAGGGG No data
1058155740_1058155744 13 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155744 9:101512779-101512801 ATTTCCTCTCCGTGGATTTAAGG No data
1058155740_1058155745 14 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155745 9:101512780-101512802 TTTCCTCTCCGTGGATTTAAGGG No data
1058155740_1058155743 5 Left 1058155740 9:101512743-101512765 CCCTGACAATAGCTTTCATCAAT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1058155743 9:101512771-101512793 TTCTACTCATTTCCTCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058155740 Original CRISPR ATTGATGAAAGCTATTGTCA GGG (reversed) Intronic
900731741 1:4266435-4266457 ATGGATGAATGCCATTGTCTTGG + Intergenic
900809929 1:4794144-4794166 CTTAATCAAAGCCATTGTCAAGG + Intergenic
900963405 1:5940209-5940231 ATGGATGAATGCCATTGTCTCGG + Intronic
905855707 1:41310990-41311012 TGTGATGAAACCAATTGTCAAGG - Intergenic
907062195 1:51439873-51439895 AATTATGAAAGCTCTTGGCATGG + Intronic
908104155 1:60824278-60824300 ATAAAAGAATGCTATTGTCAGGG + Intergenic
909922202 1:81396164-81396186 ATTGATGAAAGAAATTGTAGAGG - Intronic
910833447 1:91483609-91483631 ATGGATTAATGCTATTATCATGG - Intergenic
911001160 1:93167423-93167445 ATTGATGAAAGAAATTGAAAAGG - Intronic
911379809 1:97099058-97099080 ATTGACAAAAGCATTTGTCAGGG - Intronic
911853420 1:102847747-102847769 ATTGATGAAAGAAATTGAAAAGG + Intergenic
912110726 1:106338912-106338934 ATTGATGCAAGCAATTGAAAAGG - Intergenic
913314041 1:117535055-117535077 ATTTTTGAAAGCTATTCCCAGGG - Intergenic
916955188 1:169825276-169825298 ATTGATGAAAGTCATTTTGAGGG - Intronic
920925198 1:210334536-210334558 TTTGATGAAAGCTTTTGAGAGGG + Intronic
923800490 1:237204580-237204602 ATGGATGAGAGCTACTGACATGG - Intronic
924314590 1:242782746-242782768 ATTGATCACAGCTAATGACATGG + Intergenic
924537379 1:244947910-244947932 ACTGATGAAAGAAATTGTCGAGG + Intergenic
1063309585 10:4939760-4939782 ATTAATGAAAGCAAATGTCTAGG + Intronic
1063963495 10:11326651-11326673 TTTAATGAATGCTATTGTCCTGG - Intronic
1064551124 10:16502089-16502111 ATTTAGGAAAGTTATTCTCAAGG + Intronic
1064631678 10:17320624-17320646 ATTTATGAAAATTATTGGCATGG - Exonic
1065289169 10:24213094-24213116 ATTGATTAGAGCTATTCTTAGGG - Intronic
1068361746 10:55982884-55982906 ACTGATGAAAAATATTGTCTTGG + Intergenic
1069160006 10:65082162-65082184 ATTGATGACAGCTATTTTAATGG + Intergenic
1072569641 10:96647458-96647480 ATTAATAAAAACTATTGGCATGG + Intronic
1075145597 10:119880512-119880534 TTTGCTGAAAACTATTTTCAAGG + Intronic
1075500829 10:122972180-122972202 ATGGATGAATGCTTTTATCATGG + Intronic
1077759288 11:5073678-5073700 AGTGATTAAAGCTATTGTAAAGG - Intergenic
1079402412 11:20116480-20116502 ATTGCTGAAAGCCAAAGTCACGG + Intronic
1079636926 11:22754144-22754166 TTTGATGAAAGCTATTTTTAAGG + Intronic
1079860453 11:25663781-25663803 ATGGAAGAAAGATATTTTCAAGG - Intergenic
1080140637 11:28915437-28915459 ATTGATGTGGGCTATTTTCAAGG - Intergenic
1080445698 11:32335137-32335159 TTTGCTGAAAGCCATTTTCATGG - Intergenic
1080665023 11:34328257-34328279 AGTGATGAAATCTGTTATCAAGG + Intronic
1082242192 11:49885611-49885633 ATTAATGAAAGCTGTTGTAATGG + Intergenic
1082663913 11:55949891-55949913 ATTGATGAAACTTATTCTCTTGG - Intergenic
1082678083 11:56133714-56133736 ATTGATGAAAGAAATTGAAAAGG - Intergenic
1083579727 11:63817419-63817441 TTGGATGAAATCTATTGTCAGGG + Intronic
1085653264 11:78287972-78287994 ATTGCTGGAAGTTCTTGTCAAGG + Intronic
1085945311 11:81263410-81263432 ATTTTTGAAATTTATTGTCATGG - Intergenic
1086011354 11:82107613-82107635 ATTGATGAAAGGTAAACTCATGG - Intergenic
1086465188 11:87045782-87045804 ATTGATGAAATATATGGTGAAGG + Intronic
1086598479 11:88603821-88603843 ATTCATGAAACCTTTTGGCAGGG + Intronic
1086793221 11:91067439-91067461 ATTGATGAAAACTATTTTAAAGG - Intergenic
1086951228 11:92892235-92892257 CTTGAGGAAAGCTAATGTGAAGG + Exonic
1088393030 11:109336280-109336302 ATTGGTGCAAGCTATCCTCAAGG + Intergenic
1093414130 12:18900810-18900832 ATTGATCAAAGCAAGTCTCATGG + Intergenic
1093640231 12:21519443-21519465 ATTGAGTAAAGCTAAGGTCATGG - Intergenic
1093775506 12:23069175-23069197 ATTGATAATAGCTATTTTAAAGG - Intergenic
1094182356 12:27605178-27605200 GTTAATGAAAACTATAGTCAAGG + Intronic
1098249490 12:68554235-68554257 ACTGATGAAAGCAATTGAAAAGG + Intergenic
1098446693 12:70573357-70573379 TTTGATGTAGGTTATTGTCAAGG + Intronic
1098509416 12:71293868-71293890 ATTGAAGAAAGCCATCTTCATGG - Intronic
1099411483 12:82334363-82334385 AATGATTACAGCTTTTGTCATGG - Intronic
1099865020 12:88269279-88269301 GTTGATGAAAGATACCGTCAAGG - Intergenic
1100055735 12:90507131-90507153 ATTGATGACAGTCATTGTTAGGG + Intergenic
1100749682 12:97683944-97683966 ATTTTTGGAAGCTATTTTCATGG - Intergenic
1101536365 12:105620989-105621011 ATTGATGAAAGAAATTGAAAAGG - Intergenic
1101727957 12:107403614-107403636 ATCGGTGGAAGCTTTTGTCAAGG - Intronic
1103835177 12:123813376-123813398 ATTGGACAAAGCTATTGTGATGG + Exonic
1104689261 12:130813194-130813216 ATTTATGAAAGCTGCTGTCTAGG - Intronic
1106945133 13:34818984-34819006 ATTGATGAATGCTATTGTTTTGG - Intergenic
1107605947 13:42056907-42056929 ATTGATGAGAGATATGCTCATGG - Intronic
1108015909 13:46075518-46075540 ATGGCTGAAAGCAAATGTCATGG + Intronic
1108635488 13:52330387-52330409 ATTGATGAAAGCAATTGAGAAGG + Intergenic
1108652318 13:52492849-52492871 ATTGATGAAAGCAATTGAGAAGG - Intergenic
1108746763 13:53403954-53403976 AATGAGGAAAGCTATTGTGTGGG + Intergenic
1108782610 13:53855131-53855153 ACTGAAAAAAGCTATGGTCAAGG - Intergenic
1109046148 13:57413530-57413552 ATTGATGAAAGAAATTGAAAAGG + Intergenic
1109057103 13:57564682-57564704 ATTGTTAAAATTTATTGTCATGG + Intergenic
1110674783 13:78228668-78228690 ATTGATGCAAGCTAATCACAGGG - Intergenic
1111745691 13:92266030-92266052 ATGGATTAATGCTATTGTTAAGG - Intronic
1112925814 13:104674359-104674381 AATAATGAAAGCTATTGGCCGGG - Intergenic
1113285605 13:108845122-108845144 ACTGAAGAAAGCTATTTTCAAGG - Intronic
1113753494 13:112792521-112792543 AAGGATGAAAGCCTTTGTCATGG + Intronic
1115144389 14:30209681-30209703 ATGGATTAAAGCTGTTATCATGG - Intergenic
1118099252 14:62577553-62577575 ATTGATGAAAGAAATTAACAAGG + Intergenic
1119035220 14:71224328-71224350 ATTGATGAAGGCATTTTTCAAGG - Intergenic
1119932261 14:78559170-78559192 ATATATAAAAGCTATTGTAATGG - Intronic
1125066405 15:35491016-35491038 ATGGATTAATGCTATTATCATGG - Intronic
1125172706 15:36784407-36784429 ATTGCTCAAAGCAATTGTAAAGG + Intronic
1127031509 15:54869497-54869519 TTTGATGAAAGTTATTCTAACGG - Intergenic
1127763143 15:62160489-62160511 ATTGATGAAAGAAATTGAAAAGG + Intergenic
1127780650 15:62311617-62311639 ATTGATGAAAGAAATTGAAAAGG + Intergenic
1128965002 15:72050269-72050291 TTTGATGAAAGCTCATGTCTCGG - Intronic
1129910948 15:79225804-79225826 ATTGATGAAGGGTGTTTTCAGGG + Intergenic
1130187088 15:81694432-81694454 TTTAGTGAATGCTATTGTCATGG + Intergenic
1130746286 15:86657315-86657337 AGTGAGGAAAGCTTGTGTCAAGG - Intronic
1133638249 16:7690978-7691000 ATTGATGAAAGCATTGTTCAGGG + Intronic
1135210450 16:20521522-20521544 CATGATGAAAGGTACTGTCAGGG + Intergenic
1135491799 16:22915735-22915757 ACTGATGAAAACTAGTGGCAGGG - Exonic
1135590675 16:23702814-23702836 ATTGATTAAAGCAAGTCTCATGG - Intronic
1136651406 16:31675708-31675730 ATTGTTGAAAGGTTTTGTGAAGG - Intergenic
1138801711 16:60039291-60039313 ACTGATGAAAGAAATTGTCAAGG + Intergenic
1139219411 16:65164966-65164988 ATTTATGAAAGCCATTGTATGGG + Intergenic
1141232159 16:82178532-82178554 TTTTATGGAACCTATTGTCAAGG - Intergenic
1143047374 17:4092700-4092722 ATTGATGAAACTCATTGACATGG - Intronic
1144464803 17:15488737-15488759 TATGATGAAAGCTCTTATCATGG + Intronic
1147798526 17:43064275-43064297 ATTAATCAAAACTATTGACATGG - Intronic
1149489769 17:57075564-57075586 ATTGATGAAAGCACTTGAAATGG + Intergenic
1154046086 18:10906162-10906184 ATTGCAGAAGGCTATTTTCAGGG + Intronic
1155026679 18:21947018-21947040 ATTGATTAATGCCATTATCATGG + Intergenic
1155597713 18:27507640-27507662 ATTGATGAAAGATATTGAAGAGG + Intergenic
1155759123 18:29542654-29542676 ATTGCTCTAAGCTATTGCCAAGG + Intergenic
1156025541 18:32650066-32650088 ATTGATGAAAGATATTGAAGAGG - Intergenic
1156055999 18:33004004-33004026 ATTGATGAAAGAAATTGAAAAGG + Intronic
1156567760 18:38215040-38215062 ATTCATGAAAGGCATTGTTATGG + Intergenic
1157378909 18:47193041-47193063 ATTGATGAAAACAAGTGCCAAGG - Intergenic
1157781506 18:50444015-50444037 ATGGATTAATGCCATTGTCATGG - Intergenic
1157948474 18:52007441-52007463 AGTGATGAGAGCCATAGTCAGGG - Intergenic
1158126876 18:54109831-54109853 ATTGATGAAAGAAATTCTAAAGG + Intergenic
1158343167 18:56488125-56488147 TTTGATGAACTCTATTTTCATGG + Intergenic
1159496988 18:69219563-69219585 ACTGTTAAAAGCTTTTGTCAGGG + Intergenic
1160421437 18:78749605-78749627 ACGGATTAATGCTATTGTCACGG + Intergenic
1162709502 19:12581887-12581909 TTTGATAATAGCTATGGTCACGG - Intronic
1164411420 19:28009031-28009053 GTTGTTCAAAGCTGTTGTCAGGG + Intergenic
1164505161 19:28854219-28854241 ATTGATGAATGCTGTTATCTTGG + Intergenic
1168359238 19:55724740-55724762 CTTCATGAAAGATATGGTCATGG + Intronic
928067435 2:28179946-28179968 ATTGATGAAAGAAATTGAAAAGG + Intronic
930346242 2:50185489-50185511 ATTGGTGAAAACTAATGACATGG - Intronic
930524521 2:52510984-52511006 ATTGATTTAAGCCATTTTCAAGG - Intergenic
932101472 2:68904326-68904348 ATTGATGAAAGTTATTAAAAAGG + Intergenic
936714254 2:115166266-115166288 ATTTATGAAAGCTCTTTTCATGG - Intronic
937731648 2:125239144-125239166 ATTGATGACAGCCATTGTTTTGG - Intergenic
941249218 2:163141896-163141918 ATTTATGAAACTTATTTTCATGG + Intergenic
941879005 2:170462752-170462774 ATTGATGAAAACAATTGTAGGGG - Intronic
941927100 2:170906817-170906839 ATTGAAGGAAGCTCTTGTCATGG - Intergenic
943024888 2:182615872-182615894 ATGGATTAATGCCATTGTCATGG - Intergenic
944276546 2:197845437-197845459 AGTGGTGAAAGCCATTGCCATGG + Intronic
944287693 2:197970316-197970338 ATGGATTAATGCTATTGTCATGG - Intronic
947774044 2:232693755-232693777 ACTGATGCATGCTTTTGTCAGGG - Intergenic
1169533901 20:6515958-6515980 AGTGATGCATGCTATTATCAAGG + Intergenic
1169620381 20:7499978-7500000 ATAGATGAAAACTCTTGTCTGGG - Intergenic
1169693473 20:8359767-8359789 AATGATGAAAACTATTTTCGAGG + Intronic
1169937675 20:10902154-10902176 ATTGATATAAGCTACTGGCATGG - Intergenic
1170280007 20:14635486-14635508 ATTTATGAACACTATTGTGATGG - Intronic
1170878678 20:20275036-20275058 ATTGACCAAAGCAAGTGTCATGG - Intronic
1171308799 20:24129191-24129213 ATTGTTGCAAGTTACTGTCATGG - Intergenic
1173449964 20:43155014-43155036 TTTGATGAAAGCCATTCTAACGG - Intronic
1177899687 21:26899017-26899039 TTTGATGAAAACTATTGATATGG - Intergenic
1181284817 22:21744257-21744279 ATTGATGGAAGCGGTTGCCATGG + Intergenic
1181613427 22:24035255-24035277 AATGATGAATGCTATCGTAAGGG + Intronic
1182816495 22:33169207-33169229 ATTGATGATATATATTGTCTTGG + Intronic
1183572925 22:38667783-38667805 ATGGATTAATGCCATTGTCATGG - Intronic
949253669 3:2019316-2019338 ATTGTTGAATGCTATGTTCAAGG + Intergenic
949881539 3:8664741-8664763 ATAGATGAGAGATATTGTGAGGG - Intronic
951093840 3:18605520-18605542 TTAGATGTAAGCTATTATCAAGG - Intergenic
951866709 3:27316657-27316679 ATTGAATAAATTTATTGTCATGG - Intronic
952558053 3:34556307-34556329 ATAGATAAAAGATATTGACAGGG - Intergenic
952677236 3:36047802-36047824 ATTGATGAAAGAAATTTACAAGG - Intergenic
953300033 3:41764889-41764911 ATTTATGAAAACTATTGTGCAGG + Intronic
953692994 3:45135399-45135421 ACTGCTAACAGCTATTGTCAAGG + Intronic
954450372 3:50568262-50568284 GTGGATGGAAGCTATTGTGAGGG - Intronic
955944388 3:64178483-64178505 ATTGGTGAAAGCAAGTCTCATGG + Intronic
956246042 3:67184799-67184821 AATGATGAAAGCTATCATCATGG + Intergenic
957414773 3:79887329-79887351 AGTGAAGAAAGACATTGTCAAGG - Intergenic
959251991 3:103960739-103960761 ATTAATCATAGCTATTGTAAAGG + Intergenic
960474551 3:118108070-118108092 GTGGATCATAGCTATTGTCAAGG - Intergenic
962294708 3:134172410-134172432 ATTAAGCAAAGCTATTTTCATGG - Intronic
962470420 3:135702863-135702885 GGAGATGAAAGCTATTGTGAGGG - Intergenic
962654142 3:137525500-137525522 ATTGAAAACAGGTATTGTCAGGG - Intergenic
963359701 3:144255324-144255346 ATTGATGAAAGAAATTTTAAAGG - Intergenic
963643558 3:147885715-147885737 ATTCATGAAGGCTATTTTAATGG + Intergenic
963971413 3:151433547-151433569 ATTGATGAGAGTCATTGTGAAGG + Exonic
964052549 3:152413769-152413791 ATTGGTGAAAGAAGTTGTCAAGG + Intronic
964178622 3:153856660-153856682 ATGGATTAAAGCTGTTGTCATGG + Intergenic
964462221 3:156946111-156946133 ATTGATGAAAGAAATTGAAAAGG - Intronic
965630472 3:170727423-170727445 ATTGATAAAAGCAGTTTTCAGGG - Intronic
968312232 3:197693590-197693612 ATTGTTGTTAGCTATTGTAAGGG - Intronic
970147034 4:13046838-13046860 ATTGGTGAGAGCTACTTTCAGGG - Intergenic
970213589 4:13735784-13735806 ATTGATGAAAGCAAGTCACAGGG + Intergenic
970637468 4:18024413-18024435 ATGGATTAATGCTATTATCAAGG - Intergenic
970704874 4:18788724-18788746 ATTGGTGAAATCTATTTTCATGG + Intergenic
971129672 4:23792897-23792919 ATTGAGGAAAACTATCTTCATGG + Exonic
971198880 4:24493960-24493982 ATTAATAGTAGCTATTGTCATGG - Intergenic
972191632 4:36599489-36599511 AATTATAAAAGCTATTGTGAAGG + Intergenic
973579450 4:52327093-52327115 ATTGATGAAAGAAATTGACAAGG - Intergenic
974656335 4:64827346-64827368 CTTGGGGAAAGGTATTGTCATGG + Intergenic
975252373 4:72195030-72195052 ATTCAGGAAAGGTATTGTGATGG + Intergenic
977473610 4:97474324-97474346 ATTGTTAAAAGCAATGGTCAAGG + Intronic
979368770 4:119857852-119857874 ATTTTTGAAAGCTATTTACAAGG + Intergenic
979877553 4:125912546-125912568 TTTGATGAAAGCTATTTTTAGGG + Intergenic
979981359 4:127259411-127259433 TTTGATAAAAGCTGTTGTAATGG - Intergenic
980309529 4:131107777-131107799 ATTGATGAAAGAAATTGAAAAGG + Intergenic
981282101 4:142970333-142970355 AGTGATGAAATCTAGTCTCATGG + Intergenic
981456958 4:144963526-144963548 TTTGATGAAAGCCATTCTAATGG - Intergenic
981804100 4:148692816-148692838 ATTGATTATACCTATTCTCATGG + Intergenic
982469183 4:155766016-155766038 AGTTATGGAGGCTATTGTCATGG - Intronic
982629460 4:157813264-157813286 ATTGATGAAAGAAATTGAAAAGG + Intergenic
982885875 4:160782463-160782485 ATGGATTAACGCTATTATCATGG - Intergenic
983367139 4:166806511-166806533 ATTTGAGAAAGCTATTTTCAAGG + Intronic
984525571 4:180855448-180855470 AATCATGAAAGATATTGTAATGG - Intergenic
984901015 4:184586382-184586404 ATTCATGAGAGCTATGGGCAGGG + Intergenic
985968797 5:3358441-3358463 ACAGATGAAAGCTACTGGCATGG - Intergenic
986131191 5:4932871-4932893 ATTGATGACTGCCAATGTCAAGG + Intergenic
987174190 5:15290528-15290550 ATTGATGACAGCCCTTCTCAAGG - Intergenic
987595538 5:19993022-19993044 ATTGATAAAAGCCAGTTTCAGGG - Intronic
990591951 5:57275161-57275183 TATGAGGAAAGCTATTGTGATGG - Intergenic
991020042 5:61971099-61971121 ATTGCTAATTGCTATTGTCAGGG - Intergenic
993469935 5:88294935-88294957 ATTGATGAAAGAAATTGAAAAGG + Intergenic
995204625 5:109465577-109465599 ACAGAAGAAAGCTATTGTCTTGG - Intergenic
995917407 5:117265065-117265087 ATTGCTGAAAGGTATTATCTTGG + Intergenic
996475549 5:123915847-123915869 GTTCATGTAATCTATTGTCATGG + Intergenic
996898517 5:128515991-128516013 ATTGTTGAAATCTTTTGTAATGG - Intronic
997074991 5:130663592-130663614 ATTTAGCAAAGCTATTGTAAAGG - Intergenic
1000669638 5:164044744-164044766 AGTGGTGGAAGTTATTGTCAAGG + Intergenic
1004094550 6:12539639-12539661 ATTGATGATACTTATTCTCATGG + Intergenic
1004564484 6:16782634-16782656 ATTCCTGAAAACTATTCTCATGG + Intergenic
1007209475 6:40180708-40180730 ATAGATGAATGCTACTATCAAGG - Intergenic
1008216962 6:48804032-48804054 ATAGATGAAAGCTATTGGATTGG + Intergenic
1009525919 6:64746265-64746287 ATTAATTAATACTATTGTCAAGG + Intronic
1009740375 6:67735219-67735241 TTTGATGATAGCTATCATCATGG + Intergenic
1010560468 6:77342335-77342357 ATTGATGAAAGAAATTGAAAAGG - Intergenic
1012140087 6:95616004-95616026 ATCGATTAAAGCCATTATCATGG + Intergenic
1012346770 6:98197244-98197266 ACAGATAAAAGCTATTGACAAGG - Intergenic
1012890428 6:104890982-104891004 ATTAATTAAACTTATTGTCAAGG + Intergenic
1013805658 6:113993232-113993254 ATTGATGAAAACTAGTCACATGG - Intronic
1015396115 6:132736855-132736877 ATTAATGACAGCAATGGTCAAGG - Intergenic
1016058029 6:139599359-139599381 ATTGTTCAAAGCCATTTTCAAGG + Intergenic
1016251911 6:142053424-142053446 ATTGATGAAAGAAATTGAAATGG + Intergenic
1016542794 6:145184833-145184855 ATTGATGAAAGATATTGCAGAGG + Intergenic
1016598296 6:145826371-145826393 ATTGATGAAAGAAATTGAGAAGG + Intergenic
1020539824 7:9447117-9447139 GTTGATTAAAGCTATCATCAGGG + Intergenic
1021063982 7:16149688-16149710 ATTGATAAAAACTATTGGCCAGG + Intronic
1021947130 7:25738902-25738924 ATTGATTAAAGATATGTTCACGG - Intergenic
1022245526 7:28555401-28555423 ATTGATAAAAGGTATGGTCAGGG - Intronic
1023366565 7:39470357-39470379 ATTGAGGAAAGCCATGGTCAAGG + Intronic
1024050409 7:45617714-45617736 AATGATGAAAGATATTGACAAGG + Intronic
1024534584 7:50419576-50419598 ATAGATGAAAACTATTGTCTAGG + Intergenic
1025781803 7:64608622-64608644 ATTGGTGACAGCTGTTGCCAGGG - Intergenic
1027660511 7:80982725-80982747 CTTGATGAAAGGTATTGGAATGG - Intergenic
1028054060 7:86221999-86222021 ACTGGTGGAAGGTATTGTCATGG - Intergenic
1028299191 7:89175729-89175751 ATTGATGAAAAATATTGAAAAGG - Intronic
1031070906 7:117160525-117160547 AGAGATGAAAGGGATTGTCACGG - Intronic
1031715786 7:125107749-125107771 ATTGATGAAAGTTAGGGTCTGGG + Intergenic
1032717734 7:134525169-134525191 ATTGATCAAAGCAAGTCTCAAGG - Intergenic
1032722297 7:134560198-134560220 ATTGATCAAAGCAAGTCTCAAGG - Intronic
1040742550 8:50596481-50596503 ATAGATTAAAGCTATTTTTAAGG + Intronic
1042637060 8:70889110-70889132 ACTGATGAAAGAAATTGACAGGG - Intergenic
1043764186 8:84108542-84108564 ATTGATGAACCATGTTGTCAGGG - Intergenic
1044531216 8:93309904-93309926 CTTGAAGAAGGCTATTGTCTTGG - Intergenic
1045133880 8:99191200-99191222 ATTGCTGAAAACTAGTGTTAAGG - Intronic
1047163427 8:122408045-122408067 ATTTATGAAAGCTCCTGTCTTGG + Intergenic
1050496375 9:6246637-6246659 ATGGATTAATGCCATTGTCATGG + Intronic
1051594758 9:18813485-18813507 ATTGATGAAAGAAATTGAAAAGG - Intronic
1055869844 9:80862785-80862807 AGTTTTGAAAGATATTGTCATGG + Intergenic
1056598353 9:88026131-88026153 ATTGCTGAATGCAATTTTCAAGG - Intergenic
1057670316 9:97080716-97080738 ATTAATTAAAGTTATTCTCATGG + Intergenic
1058122598 9:101155484-101155506 ATGGATTAATGCTGTTGTCACGG - Intronic
1058155740 9:101512743-101512765 ATTGATGAAAGCTATTGTCAGGG - Intronic
1058546129 9:106061817-106061839 ATGGATTAATGCTATTATCAGGG + Intergenic
1058699535 9:107589120-107589142 AAAGTTGAAAGCTATTGTAAAGG - Intergenic
1059253418 9:112907470-112907492 AGTGATGAAATTTATTCTCATGG - Intergenic
1059477148 9:114556601-114556623 ATAGATTAATGCTATTATCACGG + Intergenic
1187202839 X:17152447-17152469 CTTGCTGTAAGCTAATGTCATGG + Exonic
1187230977 X:17422914-17422936 TTTGATGATAGCTACTGACAGGG + Intronic
1187608560 X:20914805-20914827 ATTGATTAATGCCATTATCATGG + Intergenic
1188354319 X:29172499-29172521 AATTAGGAAAGCTATTGTCTTGG + Intronic
1193192506 X:78588258-78588280 ACTGATGAAAGTAATTGACAAGG - Intergenic
1193287879 X:79735184-79735206 ATTGATGAAAGTAATTGAAAAGG + Intergenic
1195611382 X:106871503-106871525 GTTGATGATTGTTATTGTCATGG - Intronic
1197503146 X:127266406-127266428 ACTGATGAAAGAAATTGTAAAGG + Intergenic
1200956316 Y:8950030-8950052 AATAATTATAGCTATTGTCAGGG + Intergenic
1201512194 Y:14777509-14777531 ATTGATGAAAGTGTTTATCAAGG - Intronic
1201675060 Y:16571897-16571919 ATTAATGAAAGGAATTGTGATGG - Intergenic
1202106685 Y:21376924-21376946 ATTATAGATAGCTATTGTCAGGG - Intergenic